Incidental Mutation 'R5265:Kcnn1'
ID401656
Institutional Source Beutler Lab
Gene Symbol Kcnn1
Ensembl Gene ENSMUSG00000002908
Gene Namepotassium intermediate/small conductance calcium-activated channel, subfamily N, member 1
SynonymsSK1
MMRRC Submission 042833-MU
Accession Numbers
Is this an essential gene? Non essential (E-score: 0.000) question?
Stock #R5265 (G1)
Quality Score225
Status Validated
Chromosome8
Chromosomal Location70842049-70863258 bp(-) (GRCm38)
Type of Mutationmissense
DNA Base Change (assembly) T to A at 70854653 bp
ZygosityHeterozygous
Amino Acid Change Isoleucine to Phenylalanine at position 156 (I156F)
Ref Sequence ENSEMBL: ENSMUSP00000148544 (fasta)
Gene Model predicted gene model for transcript(s): [ENSMUST00000110078] [ENSMUST00000110081] [ENSMUST00000212086] [ENSMUST00000212243] [ENSMUST00000212414] [ENSMUST00000212509] [ENSMUST00000212611]
Predicted Effect probably benign
Transcript: ENSMUST00000110078
AA Change: I156F

PolyPhen 2 Score 0.066 (Sensitivity: 0.94; Specificity: 0.84)
SMART Domains Protein: ENSMUSP00000105705
Gene: ENSMUSG00000002908
AA Change: I156F

DomainStartEndE-ValueType
low complexity region 63 76 N/A INTRINSIC
Pfam:SK_channel 90 208 3.7e-59 PFAM
low complexity region 234 245 N/A INTRINSIC
Pfam:Ion_trans_2 275 369 9.6e-16 PFAM
CaMBD 382 461 1.99e-46 SMART
low complexity region 467 487 N/A INTRINSIC
low complexity region 507 516 N/A INTRINSIC
Predicted Effect probably benign
Transcript: ENSMUST00000110081
AA Change: I156F

PolyPhen 2 Score 0.030 (Sensitivity: 0.95; Specificity: 0.82)
SMART Domains Protein: ENSMUSP00000105708
Gene: ENSMUSG00000002908
AA Change: I156F

DomainStartEndE-ValueType
low complexity region 63 76 N/A INTRINSIC
Pfam:SK_channel 90 203 4.9e-51 PFAM
low complexity region 234 245 N/A INTRINSIC
Pfam:Ion_trans_2 274 368 1.7e-15 PFAM
CaMBD 382 462 3.71e-46 SMART
low complexity region 468 488 N/A INTRINSIC
low complexity region 508 517 N/A INTRINSIC
Predicted Effect probably benign
Transcript: ENSMUST00000212084
Predicted Effect probably benign
Transcript: ENSMUST00000212086
AA Change: I199F

PolyPhen 2 Score 0.025 (Sensitivity: 0.95; Specificity: 0.81)
Predicted Effect probably benign
Transcript: ENSMUST00000212243
Predicted Effect probably benign
Transcript: ENSMUST00000212414
Predicted Effect probably benign
Transcript: ENSMUST00000212509
AA Change: I156F

PolyPhen 2 Score 0.053 (Sensitivity: 0.94; Specificity: 0.84)
Predicted Effect probably benign
Transcript: ENSMUST00000212611
AA Change: I156F

PolyPhen 2 Score 0.066 (Sensitivity: 0.94; Specificity: 0.84)
Meta Mutation Damage Score 0.1252 question?
Coding Region Coverage
  • 1x: 99.2%
  • 3x: 98.5%
  • 10x: 97.0%
  • 20x: 94.7%
Validation Efficiency 100% (59/59)
MGI Phenotype FUNCTION: [Summary is not available for the mouse gene. This summary is for the human ortholog.] Action potentials in vertebrate neurons are followed by an afterhyperpolarization (AHP) that may persist for several seconds and may have profound consequences for the firing pattern of the neuron. Each component of the AHP is kinetically distinct and is mediated by different calcium-activated potassium channels. The protein encoded by this gene is activated before membrane hyperpolarization and is thought to regulate neuronal excitability by contributing to the slow component of synaptic AHP. The encoded protein is an integral membrane protein that forms a voltage-independent calcium-activated channel with three other calmodulin-binding subunits. This gene is a member of the KCNN family of potassium channel genes. [provided by RefSeq, Jul 2008]
PHENOTYPE: Homozygous null mice display normal hippocampal morphology and afterhyperpolarization currents. [provided by MGI curators]
Allele List at MGI
Other mutations in this stock
Total: 56 list
GeneRefVarChr/LocMutationPredicted EffectZygosity
1700017B05Rik A G 9: 57,258,894 W66R probably damaging Het
Adamts3 A G 5: 89,861,552 V84A possibly damaging Het
Caap1 C A 4: 94,501,228 E290* probably null Het
Cant1 G A 11: 118,408,050 R296C probably damaging Het
Ccdc114 T A 7: 45,947,435 D395E probably damaging Het
Cdh5 A T 8: 104,142,739 H699L probably benign Het
Cfdp1 T C 8: 111,830,985 T175A probably benign Het
Col4a4 C T 1: 82,493,591 G681E unknown Het
Comtd1 G A 14: 21,848,793 T27I probably benign Het
Copg1 T A 6: 87,892,270 V155D probably damaging Het
Dag1 A G 9: 108,207,699 Y748H possibly damaging Het
Dmwd T A 7: 19,080,281 N285K possibly damaging Het
Dsp A G 13: 38,195,183 E1968G possibly damaging Het
Ednra A G 8: 77,667,375 I364T probably damaging Het
Elovl3 C A 19: 46,134,681 T232K probably damaging Het
Ercc3 T A 18: 32,254,243 I503N probably damaging Het
Ercc6 C A 14: 32,569,623 A1008D probably benign Het
Gm10563 TTTC TTTCATTC 4: 155,614,496 probably null Het
H2-DMb2 G T 17: 34,148,562 V117F probably damaging Het
Helt A T 8: 46,292,433 W138R probably damaging Het
Itga11 A T 9: 62,737,412 H215L probably benign Het
Kdm1b A G 13: 47,062,969 N272D probably benign Het
Kdm2b T C 5: 122,878,588 T1161A probably damaging Het
Lin54 A G 5: 100,485,519 L102P probably damaging Het
Mlh1 A C 9: 111,271,523 M1R probably null Het
Naip2 G A 13: 100,152,560 L1165F probably damaging Het
Nfkbiz A G 16: 55,819,641 S118P probably damaging Het
Nkx3-2 T A 5: 41,761,848 M266L probably benign Het
Npr1 T C 3: 90,457,002 E771G probably benign Het
Obox8 C T 7: 14,332,029 R188H probably benign Het
Olfr187 A T 16: 59,036,143 V198D possibly damaging Het
Olfr497 T A 7: 108,423,402 V277E possibly damaging Het
Palm3 T C 8: 84,021,530 probably null Het
Palmd A T 3: 116,923,849 V333D possibly damaging Het
Pikfyve A G 1: 65,267,829 E1747G possibly damaging Het
Polr3a T C 14: 24,454,941 I1084V possibly damaging Het
Ranbp3l T A 15: 9,007,203 F127I probably benign Het
Rsl1d1 A G 16: 11,201,384 F97L possibly damaging Het
Scaper A G 9: 55,864,546 V362A probably benign Het
Scg5 A T 2: 113,776,865 L192* probably null Het
Slc34a2 T C 5: 53,061,434 I198T probably damaging Het
Slc45a3 T A 1: 131,978,194 D318E possibly damaging Het
Sorl1 A G 9: 42,106,516 M105T possibly damaging Het
St3gal5 T A 6: 72,149,131 I320N probably damaging Het
Stx17 A G 4: 48,183,470 probably benign Het
Syt5 C T 7: 4,541,075 probably null Het
Thrap3 A G 4: 126,167,640 S774P probably damaging Het
Tnc A T 4: 63,993,206 M1376K probably benign Het
Tnks1bp1 T A 2: 85,062,754 D1008E probably benign Het
Trav7-1 G T 14: 52,655,304 A105S probably damaging Het
Vmn1r28 T A 6: 58,265,964 V264D probably damaging Het
Vmn1r44 T C 6: 89,893,839 V46A probably benign Het
Vmn2r10 A G 5: 108,995,720 I788T probably damaging Het
Vmn2r78 T A 7: 86,920,124 I75N probably damaging Het
Zfp821 T C 8: 109,724,359 M328T probably damaging Het
Zfp995 G A 17: 21,880,623 P210L possibly damaging Het
Other mutations in Kcnn1
AlleleSourceChrCoordTypePredicted EffectPPH Score
IGL00492:Kcnn1 APN 8 70848062 missense probably benign
IGL00498:Kcnn1 APN 8 70852880 missense probably damaging 1.00
IGL00792:Kcnn1 APN 8 70854716 missense probably benign 0.01
IGL03122:Kcnn1 APN 8 70855080 missense probably damaging 1.00
IGL03137:Kcnn1 APN 8 70850737 missense probably damaging 0.97
IGL03222:Kcnn1 APN 8 70848199 missense probably damaging 1.00
IGL03226:Kcnn1 APN 8 70846491 splice site probably benign
R0586:Kcnn1 UTSW 8 70863869 unclassified probably benign
R1218:Kcnn1 UTSW 8 70852688 missense probably benign 0.07
R1437:Kcnn1 UTSW 8 70844551 missense probably benign 0.03
R1510:Kcnn1 UTSW 8 70864070 unclassified probably benign
R2434:Kcnn1 UTSW 8 70855166 small deletion probably benign
R2860:Kcnn1 UTSW 8 70846535 missense probably benign 0.36
R2861:Kcnn1 UTSW 8 70846535 missense probably benign 0.36
R4327:Kcnn1 UTSW 8 70852663 missense probably damaging 0.99
R4807:Kcnn1 UTSW 8 70848178 missense probably damaging 0.99
R4947:Kcnn1 UTSW 8 70844429 missense probably benign 0.02
R5685:Kcnn1 UTSW 8 70852730 missense probably damaging 1.00
R6108:Kcnn1 UTSW 8 70855156 missense probably benign 0.27
R6523:Kcnn1 UTSW 8 70846525 missense possibly damaging 0.57
R7512:Kcnn1 UTSW 8 70854649 missense possibly damaging 0.64
Predicted Primers PCR Primer
(F):5'- TCCTCAGCATCAAAGGGGTG -3'
(R):5'- GGGAAGCCACAGATACAGATCC -3'

Sequencing Primer
(F):5'- AGAGGTCCTGAGTTCAATTCCCAG -3'
(R):5'- CCATCTGGGTGGCAATTGTCC -3'
Posted On2016-07-06