Incidental Mutation 'R5265:Ednra'
ID 401657
Institutional Source Beutler Lab
Gene Symbol Ednra
Ensembl Gene ENSMUSG00000031616
Gene Name endothelin receptor type A
Synonyms Gpcr10, ET-AR, ETa
MMRRC Submission 042833-MU
Accession Numbers
Essential gene? Essential (E-score: 1.000) question?
Stock # R5265 (G1)
Quality Score 225
Status Validated
Chromosome 8
Chromosomal Location 77663031-77724464 bp(-) (GRCm38)
Type of Mutation missense
DNA Base Change (assembly) A to G at 77667375 bp (GRCm38)
Zygosity Heterozygous
Amino Acid Change Isoleucine to Threonine at position 364 (I364T)
Ref Sequence ENSEMBL: ENSMUSP00000034029 (fasta)
Gene Model predicted gene model for transcript(s): [ENSMUST00000034029]
AlphaFold Q61614
Predicted Effect probably damaging
Transcript: ENSMUST00000034029
AA Change: I364T

PolyPhen 2 Score 1.000 (Sensitivity: 0.00; Specificity: 1.00)
SMART Domains Protein: ENSMUSP00000034029
Gene: ENSMUSG00000031616
AA Change: I364T

DomainStartEndE-ValueType
signal peptide 1 20 N/A INTRINSIC
Pfam:7tm_1 97 370 8.4e-36 PFAM
low complexity region 376 394 N/A INTRINSIC
Predicted Effect noncoding transcript
Transcript: ENSMUST00000139140
Predicted Effect noncoding transcript
Transcript: ENSMUST00000146561
Predicted Effect noncoding transcript
Transcript: ENSMUST00000153937
Predicted Effect noncoding transcript
Transcript: ENSMUST00000211466
Meta Mutation Damage Score 0.8736 question?
Coding Region Coverage
  • 1x: 99.2%
  • 3x: 98.5%
  • 10x: 97.0%
  • 20x: 94.7%
Validation Efficiency 100% (59/59)
MGI Phenotype FUNCTION: [Summary is not available for the mouse gene. This summary is for the human ortholog.] This gene encodes the receptor for endothelin-1, a peptide that plays a role in potent and long-lasting vasoconstriction. This receptor associates with guanine-nucleotide-binding (G) proteins, and this coupling activates a phosphatidylinositol-calcium second messenger system. Polymorphisms in this gene have been linked to migraine headache resistance. Alternative splicing results in multiple transcript variants. [provided by RefSeq, Oct 2009]
PHENOTYPE: Homozygous inactivation of this gene results in numerous severe craniofacial defects and perinatal lethality. Aberrant middle ear development and cardiac defects, including great vessel malformations and abnormal cardiac outflow tract development, have been observed. [provided by MGI curators]
Allele List at MGI
Other mutations in this stock
Total: 56 list
GeneRefVarChr/LocMutationPredicted EffectZygosity
1700017B05Rik A G 9: 57,258,894 W66R probably damaging Het
Adamts3 A G 5: 89,861,552 V84A possibly damaging Het
Caap1 C A 4: 94,501,228 E290* probably null Het
Cant1 G A 11: 118,408,050 R296C probably damaging Het
Ccdc114 T A 7: 45,947,435 D395E probably damaging Het
Cdh5 A T 8: 104,142,739 H699L probably benign Het
Cfdp1 T C 8: 111,830,985 T175A probably benign Het
Col4a4 C T 1: 82,493,591 G681E unknown Het
Comtd1 G A 14: 21,848,793 T27I probably benign Het
Copg1 T A 6: 87,892,270 V155D probably damaging Het
Dag1 A G 9: 108,207,699 Y748H possibly damaging Het
Dmwd T A 7: 19,080,281 N285K possibly damaging Het
Dsp A G 13: 38,195,183 E1968G possibly damaging Het
Elovl3 C A 19: 46,134,681 T232K probably damaging Het
Ercc3 T A 18: 32,254,243 I503N probably damaging Het
Ercc6 C A 14: 32,569,623 A1008D probably benign Het
Gm10563 TTTC TTTCATTC 4: 155,614,496 probably null Het
H2-DMb2 G T 17: 34,148,562 V117F probably damaging Het
Helt A T 8: 46,292,433 W138R probably damaging Het
Itga11 A T 9: 62,737,412 H215L probably benign Het
Kcnn1 T A 8: 70,854,653 I156F probably benign Het
Kdm1b A G 13: 47,062,969 N272D probably benign Het
Kdm2b T C 5: 122,878,588 T1161A probably damaging Het
Lin54 A G 5: 100,485,519 L102P probably damaging Het
Mlh1 A C 9: 111,271,523 M1R probably null Het
Naip2 G A 13: 100,152,560 L1165F probably damaging Het
Nfkbiz A G 16: 55,819,641 S118P probably damaging Het
Nkx3-2 T A 5: 41,761,848 M266L probably benign Het
Npr1 T C 3: 90,457,002 E771G probably benign Het
Obox8 C T 7: 14,332,029 R188H probably benign Het
Olfr187 A T 16: 59,036,143 V198D possibly damaging Het
Olfr497 T A 7: 108,423,402 V277E possibly damaging Het
Palm3 T C 8: 84,021,530 probably null Het
Palmd A T 3: 116,923,849 V333D possibly damaging Het
Pikfyve A G 1: 65,267,829 E1747G possibly damaging Het
Polr3a T C 14: 24,454,941 I1084V possibly damaging Het
Ranbp3l T A 15: 9,007,203 F127I probably benign Het
Rsl1d1 A G 16: 11,201,384 F97L possibly damaging Het
Scaper A G 9: 55,864,546 V362A probably benign Het
Scg5 A T 2: 113,776,865 L192* probably null Het
Slc34a2 T C 5: 53,061,434 I198T probably damaging Het
Slc45a3 T A 1: 131,978,194 D318E possibly damaging Het
Sorl1 A G 9: 42,106,516 M105T possibly damaging Het
St3gal5 T A 6: 72,149,131 I320N probably damaging Het
Stx17 A G 4: 48,183,470 probably benign Het
Syt5 C T 7: 4,541,075 probably null Het
Thrap3 A G 4: 126,167,640 S774P probably damaging Het
Tnc A T 4: 63,993,206 M1376K probably benign Het
Tnks1bp1 T A 2: 85,062,754 D1008E probably benign Het
Trav7-1 G T 14: 52,655,304 A105S probably damaging Het
Vmn1r28 T A 6: 58,265,964 V264D probably damaging Het
Vmn1r44 T C 6: 89,893,839 V46A probably benign Het
Vmn2r10 A G 5: 108,995,720 I788T probably damaging Het
Vmn2r78 T A 7: 86,920,124 I75N probably damaging Het
Zfp821 T C 8: 109,724,359 M328T probably damaging Het
Zfp995 G A 17: 21,880,623 P210L possibly damaging Het
Other mutations in Ednra
AlleleSourceChrCoordTypePredicted EffectPPH Score
IGL00899:Ednra APN 8 77675071 missense probably damaging 1.00
IGL02943:Ednra APN 8 77720054 missense probably damaging 1.00
IGL03213:Ednra APN 8 77720219 missense probably benign
Starved UTSW 8 77675067 missense possibly damaging 0.82
R0058:Ednra UTSW 8 77667322 critical splice donor site probably null
R0080:Ednra UTSW 8 77675059 missense probably benign
R0894:Ednra UTSW 8 77720020 splice site probably benign
R1746:Ednra UTSW 8 77671582 missense probably benign 0.44
R1872:Ednra UTSW 8 77720396 missense possibly damaging 0.46
R1934:Ednra UTSW 8 77689118 missense possibly damaging 0.55
R3776:Ednra UTSW 8 77675095 missense probably damaging 1.00
R4177:Ednra UTSW 8 77675048 missense possibly damaging 0.54
R4274:Ednra UTSW 8 77720302 missense probably benign 0.01
R4544:Ednra UTSW 8 77674911 critical splice donor site probably null
R4697:Ednra UTSW 8 77664995 missense probably benign 0.01
R4704:Ednra UTSW 8 77667963 intron probably benign
R4863:Ednra UTSW 8 77667383 missense probably damaging 1.00
R5346:Ednra UTSW 8 77674968 missense probably damaging 1.00
R5772:Ednra UTSW 8 77675067 missense possibly damaging 0.82
R6005:Ednra UTSW 8 77674927 missense possibly damaging 0.91
R6147:Ednra UTSW 8 77667322 critical splice donor site probably benign
R6384:Ednra UTSW 8 77689094 missense probably damaging 1.00
R6743:Ednra UTSW 8 77675089 missense probably damaging 0.99
R7084:Ednra UTSW 8 77665105 nonsense probably null
R8345:Ednra UTSW 8 77689184 missense probably damaging 1.00
R9421:Ednra UTSW 8 77665052 missense probably damaging 1.00
R9497:Ednra UTSW 8 77720305 missense probably benign 0.00
R9498:Ednra UTSW 8 77720305 missense probably benign 0.00
R9570:Ednra UTSW 8 77667332 missense possibly damaging 0.73
Predicted Primers PCR Primer
(F):5'- TGCCTGATCAAAGCAGTAGC -3'
(R):5'- ACTAAGCAATGCAATGATCCTGC -3'

Sequencing Primer
(F):5'- GCAAAACTGAATTGTCTGTGACTG -3'
(R):5'- CAATGATCCTGCAGTGCTTC -3'
Posted On 2016-07-06