Mutagenetix > Incidental Mutation

Incidental Mutation 'R5265:Sorl1'

401662

Institutional Source

Beutler Lab

Gene Symbol

Sorl1

Ensembl Gene

ENSMUSG00000049313

Gene Name

sortilin-related receptor, LDLR class A repeats-containing

Synonyms

2900010L19Rik, mSorLA, Sorla, LR11

MMRRC Submission

042833-MU

Accession Numbers

Genbank: NM_011436; MGI: 1202296

Essential gene?

Possibly non essential (E-score: 0.337) question?

Stock #

R5265 (G1)

Quality Score

225

Status

Validated

Chromosome

Chromosomal Location

41964720-42124297 bp(-) (GRCm38)

Type of Mutation

missense

DNA Base Change (assembly)

A to G at 42106516 bp (GRCm38)

Zygosity

Heterozygous

Amino Acid Change

Methionine to Threonine at position 105 (M105T)

Ref Sequence

ENSEMBL: ENSMUSP00000058613 (fasta)

Gene Model

predicted gene model for transcript(s): [ENSMUST00000060989]

AlphaFold

O88307

Predicted Effect

possibly damaging
Transcript: ENSMUST00000060989
AA Change: M105T

PolyPhen 2 Score 0.795 (Sensitivity: 0.85; Specificity: 0.93)

SMART Domains

Protein: ENSMUSP00000058613
Gene: ENSMUSG00000049313
AA Change: M105T

Domain	Start	End	E-Value	Type
signal peptide	1	28	N/A	INTRINSIC
VPS10	124	757	N/A	SMART
LY	780	822	9.33e-6	SMART
LY	824	866	2.38e-12	SMART
LY	867	912	1.87e-5	SMART
LY	913	953	1.08e-10	SMART
LY	954	993	5.43e0	SMART
EGF_like	1020	1072	2.8e1	SMART
LDLa	1077	1114	1.76e-14	SMART
LDLa	1116	1155	5.34e-14	SMART
LDLa	1157	1194	1.67e-15	SMART
EGF_like	1198	1236	4.93e1	SMART
LDLa	1198	1237	3.83e-15	SMART
LDLa	1238	1273	1.99e-13	SMART
LDLa	1274	1317	2.53e-6	SMART
LDLa	1324	1361	4.34e-14	SMART
LDLa	1367	1405	1.14e-13	SMART
LDLa	1418	1455	3.34e-15	SMART
LDLa	1470	1508	1.09e-10	SMART
LDLa	1513	1551	1.09e-10	SMART
FN3	1555	1638	4.19e-4	SMART
FN3	1651	1732	7.23e-8	SMART
FN3	1747	1830	4.8e0	SMART
FN3	1842	1920	3e1	SMART
FN3	1933	2016	6.01e-5	SMART
FN3	2025	2107	2.03e-2	SMART
transmembrane domain	2137	2159	N/A	INTRINSIC
low complexity region	2188	2199	N/A	INTRINSIC

Meta Mutation Damage Score

0.2573

Coding Region Coverage

1x: 99.2%
3x: 98.5%
10x: 97.0%
20x: 94.7%

Validation Efficiency

100% (59/59)

MGI Phenotype

FUNCTION: [Summary is not available for the mouse gene. This summary is for the human ortholog.] This gene encodes a mosaic protein that belongs to at least two families: the vacuolar protein sorting 10 (VPS10) domain-containing receptor family, and the low density lipoprotein receptor (LDLR) family. The encoded protein also contains fibronectin type III repeats and an epidermal growth factor repeat. The encoded preproprotein is proteolytically processed to generate the mature receptor, which likely plays roles in endocytosis and sorting. Mutations in this gene may be associated with Alzheimer's disease. [provided by RefSeq, Feb 2016]
PHENOTYPE: Homozygous mutation of this gene results in decreased femoral artery intimal thickness after cuff placement and abolished angiotensin II stimulated vascular smooth muscle migration and attachment. Two other alleles show an increase in beta-amyloid deposits or peptide in the brain. [provided by MGI curators]

Allele List at MGI

All alleles(15) : Targeted, knock-out(2) Gene trapped(13)

Other mutations in this stock

Total: 56 list
Gene	Ref	Var	Chr/Loc	Mutation	Predicted Effect	Zygosity
1700017B05Rik	A	G	9: 57,258,894	W66R	probably damaging	Het
Adamts3	A	G	5: 89,861,552	V84A	possibly damaging	Het
Caap1	C	A	4: 94,501,228	E290*	probably null	Het
Cant1	G	A	11: 118,408,050	R296C	probably damaging	Het
Ccdc114	T	A	7: 45,947,435	D395E	probably damaging	Het
Cdh5	A	T	8: 104,142,739	H699L	probably benign	Het
Cfdp1	T	C	8: 111,830,985	T175A	probably benign	Het
Col4a4	C	T	1: 82,493,591	G681E	unknown	Het
Comtd1	G	A	14: 21,848,793	T27I	probably benign	Het
Copg1	T	A	6: 87,892,270	V155D	probably damaging	Het
Dag1	A	G	9: 108,207,699	Y748H	possibly damaging	Het
Dmwd	T	A	7: 19,080,281	N285K	possibly damaging	Het
Dsp	A	G	13: 38,195,183	E1968G	possibly damaging	Het
Ednra	A	G	8: 77,667,375	I364T	probably damaging	Het
Elovl3	C	A	19: 46,134,681	T232K	probably damaging	Het
Ercc3	T	A	18: 32,254,243	I503N	probably damaging	Het
Ercc6	C	A	14: 32,569,623	A1008D	probably benign	Het
Gm10563	TTTC	TTTCATTC	4: 155,614,496		probably null	Het
H2-DMb2	G	T	17: 34,148,562	V117F	probably damaging	Het
Helt	A	T	8: 46,292,433	W138R	probably damaging	Het
Itga11	A	T	9: 62,737,412	H215L	probably benign	Het
Kcnn1	T	A	8: 70,854,653	I156F	probably benign	Het
Kdm1b	A	G	13: 47,062,969	N272D	probably benign	Het
Kdm2b	T	C	5: 122,878,588	T1161A	probably damaging	Het
Lin54	A	G	5: 100,485,519	L102P	probably damaging	Het
Mlh1	A	C	9: 111,271,523	M1R	probably null	Het
Naip2	G	A	13: 100,152,560	L1165F	probably damaging	Het
Nfkbiz	A	G	16: 55,819,641	S118P	probably damaging	Het
Nkx3-2	T	A	5: 41,761,848	M266L	probably benign	Het
Npr1	T	C	3: 90,457,002	E771G	probably benign	Het
Obox8	C	T	7: 14,332,029	R188H	probably benign	Het
Olfr187	A	T	16: 59,036,143	V198D	possibly damaging	Het
Olfr497	T	A	7: 108,423,402	V277E	possibly damaging	Het
Palm3	T	C	8: 84,021,530		probably null	Het
Palmd	A	T	3: 116,923,849	V333D	possibly damaging	Het
Pikfyve	A	G	1: 65,267,829	E1747G	possibly damaging	Het
Polr3a	T	C	14: 24,454,941	I1084V	possibly damaging	Het
Ranbp3l	T	A	15: 9,007,203	F127I	probably benign	Het
Rsl1d1	A	G	16: 11,201,384	F97L	possibly damaging	Het
Scaper	A	G	9: 55,864,546	V362A	probably benign	Het
Scg5	A	T	2: 113,776,865	L192*	probably null	Het
Slc34a2	T	C	5: 53,061,434	I198T	probably damaging	Het
Slc45a3	T	A	1: 131,978,194	D318E	possibly damaging	Het
St3gal5	T	A	6: 72,149,131	I320N	probably damaging	Het
Stx17	A	G	4: 48,183,470		probably benign	Het
Syt5	C	T	7: 4,541,075		probably null	Het
Thrap3	A	G	4: 126,167,640	S774P	probably damaging	Het
Tnc	A	T	4: 63,993,206	M1376K	probably benign	Het
Tnks1bp1	T	A	2: 85,062,754	D1008E	probably benign	Het
Trav7-1	G	T	14: 52,655,304	A105S	probably damaging	Het
Vmn1r28	T	A	6: 58,265,964	V264D	probably damaging	Het
Vmn1r44	T	C	6: 89,893,839	V46A	probably benign	Het
Vmn2r10	A	G	5: 108,995,720	I788T	probably damaging	Het
Vmn2r78	T	A	7: 86,920,124	I75N	probably damaging	Het
Zfp821	T	C	8: 109,724,359	M328T	probably damaging	Het
Zfp995	G	A	17: 21,880,623	P210L	possibly damaging	Het

Other mutations in Sorl1

Allele	Source	Chr	Coord	Type	Predicted Effect	PPH Score
IGL00087:Sorl1	APN	9	41974094	missense	probably damaging	1.00
IGL01303:Sorl1	APN	9	42024478	splice site	probably benign
IGL01545:Sorl1	APN	9	42043956	missense	probably damaging	1.00
IGL01629:Sorl1	APN	9	42057269	critical splice donor site	probably null
IGL01670:Sorl1	APN	9	42001492	missense	possibly damaging	0.81
IGL01684:Sorl1	APN	9	41980711	missense	probably damaging	0.96
IGL02154:Sorl1	APN	9	42004034	missense	probably benign
IGL02215:Sorl1	APN	9	42018182	missense	probably damaging	0.97
IGL02427:Sorl1	APN	9	42041690	missense	probably damaging	1.00
IGL02590:Sorl1	APN	9	42046561	missense	probably benign	0.01
IGL02794:Sorl1	APN	9	42063774	missense	probably damaging	0.98
IGL02797:Sorl1	APN	9	42037059	missense	probably damaging	0.99
IGL02987:Sorl1	APN	9	42041053	missense	probably damaging	1.00
IGL03005:Sorl1	APN	9	42057325	missense	probably damaging	1.00
IGL03069:Sorl1	APN	9	41991426	missense	probably benign
IGL03288:Sorl1	APN	9	42033562	splice site	probably benign
N/A - 287:Sorl1	UTSW	9	42041596	nonsense	probably null
PIT4151001:Sorl1	UTSW	9	41968622	missense	probably damaging	1.00
R0117:Sorl1	UTSW	9	42033577	missense	probably benign	0.10
R0173:Sorl1	UTSW	9	42067933	missense	probably damaging	0.99
R0318:Sorl1	UTSW	9	42081954	missense	probably damaging	1.00
R0385:Sorl1	UTSW	9	42031909	missense	probably damaging	0.99
R0448:Sorl1	UTSW	9	42004088	missense	probably damaging	1.00
R0492:Sorl1	UTSW	9	41991371	missense	probably null	0.00
R0512:Sorl1	UTSW	9	42067832	missense	probably benign	0.01
R0587:Sorl1	UTSW	9	41984506	missense	probably damaging	1.00
R0600:Sorl1	UTSW	9	42043900	splice site	probably benign
R0831:Sorl1	UTSW	9	42071069	splice site	probably benign
R0924:Sorl1	UTSW	9	42008174	splice site	probably benign
R1013:Sorl1	UTSW	9	42002559	missense	probably benign	0.00
R1053:Sorl1	UTSW	9	41991456	missense	probably benign
R1077:Sorl1	UTSW	9	42014490	missense	probably damaging	1.00
R1326:Sorl1	UTSW	9	42031796	missense	probably benign	0.14
R1348:Sorl1	UTSW	9	42000412	splice site	probably null
R1498:Sorl1	UTSW	9	42041073	missense	probably damaging	1.00
R1671:Sorl1	UTSW	9	41974000	missense	probably damaging	1.00
R1713:Sorl1	UTSW	9	41996242	missense	probably benign	0.06
R1738:Sorl1	UTSW	9	42089965	missense	probably benign	0.33
R1779:Sorl1	UTSW	9	41991482	critical splice acceptor site	probably null
R1871:Sorl1	UTSW	9	41969725	nonsense	probably null
R1912:Sorl1	UTSW	9	42081950	missense	probably damaging	1.00
R1952:Sorl1	UTSW	9	42046624	missense	probably benign
R2071:Sorl1	UTSW	9	41979457	missense	possibly damaging	0.71
R2153:Sorl1	UTSW	9	41984492	missense	probably benign	0.01
R2417:Sorl1	UTSW	9	41980711	missense	probably damaging	0.96
R2429:Sorl1	UTSW	9	42037070	missense	probably damaging	1.00
R2866:Sorl1	UTSW	9	41969781	missense	probably benign
R3815:Sorl1	UTSW	9	42064049	missense	possibly damaging	0.71
R3816:Sorl1	UTSW	9	42064049	missense	possibly damaging	0.71
R3817:Sorl1	UTSW	9	42064049	missense	possibly damaging	0.71
R3819:Sorl1	UTSW	9	42064049	missense	possibly damaging	0.71
R3890:Sorl1	UTSW	9	42004105	missense	probably damaging	1.00
R3941:Sorl1	UTSW	9	41989468	critical splice acceptor site	probably null
R4409:Sorl1	UTSW	9	42035448	missense	probably damaging	0.99
R4410:Sorl1	UTSW	9	42003992	nonsense	probably null
R4610:Sorl1	UTSW	9	42031914	missense	possibly damaging	0.65
R4664:Sorl1	UTSW	9	42004051	missense	probably damaging	0.97
R4666:Sorl1	UTSW	9	42004051	missense	probably damaging	0.97
R4668:Sorl1	UTSW	9	41984508	missense	probably damaging	1.00
R4823:Sorl1	UTSW	9	41992321	missense	probably damaging	1.00
R4874:Sorl1	UTSW	9	42063752	missense	probably damaging	0.99
R4898:Sorl1	UTSW	9	42041639	missense	probably damaging	1.00
R4922:Sorl1	UTSW	9	42014450	splice site	probably null
R4976:Sorl1	UTSW	9	41983003	missense	probably benign	0.00
R4984:Sorl1	UTSW	9	41991342	missense	probably damaging	1.00
R5046:Sorl1	UTSW	9	41996294	missense	probably benign
R5070:Sorl1	UTSW	9	42031818	missense	possibly damaging	0.82
R5084:Sorl1	UTSW	9	41976377	missense	probably benign	0.01
R5202:Sorl1	UTSW	9	42033583	missense	probably benign	0.00
R5275:Sorl1	UTSW	9	42030902	missense	probably benign	0.33
R5368:Sorl1	UTSW	9	41979390	missense	probably benign	0.00
R5385:Sorl1	UTSW	9	42057284	missense	possibly damaging	0.83
R5386:Sorl1	UTSW	9	42057284	missense	possibly damaging	0.83
R5416:Sorl1	UTSW	9	42002636	nonsense	probably null
R5518:Sorl1	UTSW	9	42037212	missense	possibly damaging	0.92
R5545:Sorl1	UTSW	9	41991625	missense	probably benign	0.08
R5864:Sorl1	UTSW	9	42092373	missense	probably damaging	1.00
R5865:Sorl1	UTSW	9	41983034	missense	possibly damaging	0.94
R6339:Sorl1	UTSW	9	41969742	missense	probably benign	0.10
R6484:Sorl1	UTSW	9	41976407	missense	probably damaging	1.00
R6505:Sorl1	UTSW	9	42071234	missense	probably damaging	1.00
R6591:Sorl1	UTSW	9	42002567	missense	probably damaging	1.00
R6596:Sorl1	UTSW	9	42001603	missense	possibly damaging	0.81
R6654:Sorl1	UTSW	9	41980645	missense	possibly damaging	0.47
R6691:Sorl1	UTSW	9	42002567	missense	probably damaging	1.00
R6702:Sorl1	UTSW	9	42071201	missense	probably damaging	0.97
R6703:Sorl1	UTSW	9	42071201	missense	probably damaging	0.97
R6775:Sorl1	UTSW	9	42092452	missense	possibly damaging	0.93
R6792:Sorl1	UTSW	9	42099263	missense	probably damaging	1.00
R6852:Sorl1	UTSW	9	42024398	missense	possibly damaging	0.90
R6860:Sorl1	UTSW	9	42022392	missense	probably benign	0.01
R6925:Sorl1	UTSW	9	42033626	missense	probably damaging	1.00
R7022:Sorl1	UTSW	9	41969751	missense	probably benign	0.11
R7033:Sorl1	UTSW	9	42030983	missense	possibly damaging	0.93
R7091:Sorl1	UTSW	9	42002634	missense	probably benign	0.00
R7267:Sorl1	UTSW	9	42124079	missense	possibly damaging	0.63
R7269:Sorl1	UTSW	9	42037203	missense	probably damaging	0.99
R7272:Sorl1	UTSW	9	42063710	splice site	probably null
R7537:Sorl1	UTSW	9	41980688	missense	probably benign	0.01
R7615:Sorl1	UTSW	9	41977582	missense	possibly damaging	0.91
R7636:Sorl1	UTSW	9	42092334	missense	possibly damaging	0.90
R7727:Sorl1	UTSW	9	41984526	missense	probably damaging	1.00
R7763:Sorl1	UTSW	9	42043909	missense	probably damaging	1.00
R7831:Sorl1	UTSW	9	42089961	missense	probably benign	0.17
R7956:Sorl1	UTSW	9	41989359	missense	probably damaging	1.00
R7964:Sorl1	UTSW	9	41991401	missense	probably damaging	1.00
R7977:Sorl1	UTSW	9	41977561	missense	probably damaging	1.00
R7987:Sorl1	UTSW	9	41977561	missense	probably damaging	1.00
R8151:Sorl1	UTSW	9	42067933	missense	probably damaging	0.99
R8219:Sorl1	UTSW	9	42041561	splice site	probably null
R8261:Sorl1	UTSW	9	42014481	missense	probably damaging	1.00
R8283:Sorl1	UTSW	9	42030998	missense	probably damaging	1.00
R8308:Sorl1	UTSW	9	42018160	missense	probably damaging	1.00
R8348:Sorl1	UTSW	9	41991745	missense	probably benign	0.35
R8448:Sorl1	UTSW	9	41991745	missense	probably benign	0.35
R8524:Sorl1	UTSW	9	41974074	missense	probably damaging	1.00
R8869:Sorl1	UTSW	9	42022426	missense	probably benign	0.01
R8898:Sorl1	UTSW	9	42000271	missense	probably damaging	1.00
R8972:Sorl1	UTSW	9	42046552	missense	probably damaging	1.00
R9012:Sorl1	UTSW	9	42071195	missense	probably damaging	1.00
R9094:Sorl1	UTSW	9	42063754	missense	possibly damaging	0.92
R9241:Sorl1	UTSW	9	41974124	nonsense	probably null
R9278:Sorl1	UTSW	9	42046561	missense	probably benign	0.01
R9288:Sorl1	UTSW	9	42041631	missense	probably damaging	1.00
R9303:Sorl1	UTSW	9	41989443	missense	probably damaging	1.00
R9330:Sorl1	UTSW	9	42067933	missense	probably damaging	1.00
R9332:Sorl1	UTSW	9	42001518	missense	probably damaging	1.00
R9468:Sorl1	UTSW	9	42124088	missense	probably benign	0.20
R9528:Sorl1	UTSW	9	42022335	critical splice donor site	probably null
R9544:Sorl1	UTSW	9	42081809	nonsense	probably null
R9563:Sorl1	UTSW	9	42046597	missense	probably damaging	1.00
R9564:Sorl1	UTSW	9	42046597	missense	probably damaging	1.00
R9588:Sorl1	UTSW	9	42081809	nonsense	probably null
R9634:Sorl1	UTSW	9	41996294	missense	probably benign
R9671:Sorl1	UTSW	9	42031781	missense	possibly damaging	0.85
R9701:Sorl1	UTSW	9	42092470	missense	probably damaging	1.00
Z1176:Sorl1	UTSW	9	42099203	missense	possibly damaging	0.64
Z1176:Sorl1	UTSW	9	42123948	missense	probably benign	0.03
Z1177:Sorl1	UTSW	9	41991638	missense	possibly damaging	0.92
Z1177:Sorl1	UTSW	9	42106541	missense	probably benign	0.00
Z1177:Sorl1	UTSW	9	42123912	missense	probably damaging	1.00
Z31818:Sorl1	UTSW	9	42041596	nonsense	probably null

Predicted Primers

PCR Primer
(F):5'- GGGATGCACGCATTACTTTCC -3'
(R):5'- GTAGAACTTGCAGGGCAGTG -3'

Sequencing Primer
(F):5'- GGGATGCACGCATTACTTTCCATATC -3'
(R):5'- TGAGAAGCGTCTGCCCTGAC -3'

Posted On

2016-07-06