Incidental Mutation 'R5265:Cant1'
ID401668
Institutional Source Beutler Lab
Gene Symbol Cant1
Ensembl Gene ENSMUSG00000025575
Gene Namecalcium activated nucleotidase 1
Synonyms5830420C20Rik, D11Bwg0554e, SCAN-1, Apy1h, Shapy
MMRRC Submission 042833-MU
Accession Numbers
Is this an essential gene? Probably non essential (E-score: 0.109) question?
Stock #R5265 (G1)
Quality Score225
Status Validated
Chromosome11
Chromosomal Location118406289-118419086 bp(-) (GRCm38)
Type of Mutationmissense
DNA Base Change (assembly) G to A at 118408050 bp
ZygosityHeterozygous
Amino Acid Change Arginine to Cysteine at position 296 (R296C)
Ref Sequence ENSEMBL: ENSMUSP00000126919 (fasta)
Gene Model predicted gene model for transcript(s): [ENSMUST00000017620] [ENSMUST00000092378] [ENSMUST00000106287] [ENSMUST00000106288] [ENSMUST00000106289] [ENSMUST00000164927]
Predicted Effect probably damaging
Transcript: ENSMUST00000017620
AA Change: R296C

PolyPhen 2 Score 0.999 (Sensitivity: 0.14; Specificity: 0.99)
SMART Domains Protein: ENSMUSP00000017620
Gene: ENSMUSG00000025575
AA Change: R296C

DomainStartEndE-ValueType
Pfam:Apyrase 115 403 7e-140 PFAM
Predicted Effect probably damaging
Transcript: ENSMUST00000092378
AA Change: R296C

PolyPhen 2 Score 0.999 (Sensitivity: 0.14; Specificity: 0.99)
SMART Domains Protein: ENSMUSP00000090032
Gene: ENSMUSG00000025575
AA Change: R296C

DomainStartEndE-ValueType
Pfam:Apyrase 115 403 7e-140 PFAM
Predicted Effect probably damaging
Transcript: ENSMUST00000106287
AA Change: R296C

PolyPhen 2 Score 0.999 (Sensitivity: 0.14; Specificity: 0.99)
SMART Domains Protein: ENSMUSP00000101894
Gene: ENSMUSG00000025575
AA Change: R296C

DomainStartEndE-ValueType
Pfam:Apyrase 115 403 7e-140 PFAM
Predicted Effect probably damaging
Transcript: ENSMUST00000106288
AA Change: R296C

PolyPhen 2 Score 0.999 (Sensitivity: 0.14; Specificity: 0.99)
SMART Domains Protein: ENSMUSP00000101895
Gene: ENSMUSG00000025575
AA Change: R296C

DomainStartEndE-ValueType
Pfam:Apyrase 115 403 7e-140 PFAM
Predicted Effect probably damaging
Transcript: ENSMUST00000106289
AA Change: R333C

PolyPhen 2 Score 0.996 (Sensitivity: 0.55; Specificity: 0.98)
SMART Domains Protein: ENSMUSP00000101896
Gene: ENSMUSG00000025575
AA Change: R333C

DomainStartEndE-ValueType
Pfam:Apyrase 115 216 6.3e-39 PFAM
Pfam:Apyrase 244 440 3.4e-92 PFAM
Predicted Effect probably damaging
Transcript: ENSMUST00000164927
AA Change: R296C

PolyPhen 2 Score 0.999 (Sensitivity: 0.14; Specificity: 0.99)
SMART Domains Protein: ENSMUSP00000126919
Gene: ENSMUSG00000025575
AA Change: R296C

DomainStartEndE-ValueType
Pfam:Apyrase 115 403 7e-140 PFAM
Meta Mutation Damage Score 0.8628 question?
Coding Region Coverage
  • 1x: 99.2%
  • 3x: 98.5%
  • 10x: 97.0%
  • 20x: 94.7%
Validation Efficiency 100% (59/59)
MGI Phenotype FUNCTION: The protein encoded by this gene is a calcium-dependent nucleotidase that preferentially hydrolyzes UDP, GDP, and IDP. The encoded protein has low activity with ADP and ATP and shows no activity with AMP and GMP. Several transcript variants encoding two different isoforms have been found for this gene. [provided by RefSeq, Jun 2012]
Allele List at MGI
Other mutations in this stock
Total: 56 list
GeneRefVarChr/LocMutationPredicted EffectZygosity
1700017B05Rik A G 9: 57,258,894 W66R probably damaging Het
Adamts3 A G 5: 89,861,552 V84A possibly damaging Het
Caap1 C A 4: 94,501,228 E290* probably null Het
Ccdc114 T A 7: 45,947,435 D395E probably damaging Het
Cdh5 A T 8: 104,142,739 H699L probably benign Het
Cfdp1 T C 8: 111,830,985 T175A probably benign Het
Col4a4 C T 1: 82,493,591 G681E unknown Het
Comtd1 G A 14: 21,848,793 T27I probably benign Het
Copg1 T A 6: 87,892,270 V155D probably damaging Het
Dag1 A G 9: 108,207,699 Y748H possibly damaging Het
Dmwd T A 7: 19,080,281 N285K possibly damaging Het
Dsp A G 13: 38,195,183 E1968G possibly damaging Het
Ednra A G 8: 77,667,375 I364T probably damaging Het
Elovl3 C A 19: 46,134,681 T232K probably damaging Het
Ercc3 T A 18: 32,254,243 I503N probably damaging Het
Ercc6 C A 14: 32,569,623 A1008D probably benign Het
Gm10563 TTTC TTTCATTC 4: 155,614,496 probably null Het
H2-DMb2 G T 17: 34,148,562 V117F probably damaging Het
Helt A T 8: 46,292,433 W138R probably damaging Het
Itga11 A T 9: 62,737,412 H215L probably benign Het
Kcnn1 T A 8: 70,854,653 I156F probably benign Het
Kdm1b A G 13: 47,062,969 N272D probably benign Het
Kdm2b T C 5: 122,878,588 T1161A probably damaging Het
Lin54 A G 5: 100,485,519 L102P probably damaging Het
Mlh1 A C 9: 111,271,523 M1R probably null Het
Naip2 G A 13: 100,152,560 L1165F probably damaging Het
Nfkbiz A G 16: 55,819,641 S118P probably damaging Het
Nkx3-2 T A 5: 41,761,848 M266L probably benign Het
Npr1 T C 3: 90,457,002 E771G probably benign Het
Obox8 C T 7: 14,332,029 R188H probably benign Het
Olfr187 A T 16: 59,036,143 V198D possibly damaging Het
Olfr497 T A 7: 108,423,402 V277E possibly damaging Het
Palm3 T C 8: 84,021,530 probably null Het
Palmd A T 3: 116,923,849 V333D possibly damaging Het
Pikfyve A G 1: 65,267,829 E1747G possibly damaging Het
Polr3a T C 14: 24,454,941 I1084V possibly damaging Het
Ranbp3l T A 15: 9,007,203 F127I probably benign Het
Rsl1d1 A G 16: 11,201,384 F97L possibly damaging Het
Scaper A G 9: 55,864,546 V362A probably benign Het
Scg5 A T 2: 113,776,865 L192* probably null Het
Slc34a2 T C 5: 53,061,434 I198T probably damaging Het
Slc45a3 T A 1: 131,978,194 D318E possibly damaging Het
Sorl1 A G 9: 42,106,516 M105T possibly damaging Het
St3gal5 T A 6: 72,149,131 I320N probably damaging Het
Stx17 A G 4: 48,183,470 probably benign Het
Syt5 C T 7: 4,541,075 probably null Het
Thrap3 A G 4: 126,167,640 S774P probably damaging Het
Tnc A T 4: 63,993,206 M1376K probably benign Het
Tnks1bp1 T A 2: 85,062,754 D1008E probably benign Het
Trav7-1 G T 14: 52,655,304 A105S probably damaging Het
Vmn1r28 T A 6: 58,265,964 V264D probably damaging Het
Vmn1r44 T C 6: 89,893,839 V46A probably benign Het
Vmn2r10 A G 5: 108,995,720 I788T probably damaging Het
Vmn2r78 T A 7: 86,920,124 I75N probably damaging Het
Zfp821 T C 8: 109,724,359 M328T probably damaging Het
Zfp995 G A 17: 21,880,623 P210L possibly damaging Het
Other mutations in Cant1
AlleleSourceChrCoordTypePredicted EffectPPH Score
IGL02927:Cant1 APN 11 118411062 missense probably benign 0.01
IGL02989:Cant1 APN 11 118411212 missense probably damaging 1.00
R0512:Cant1 UTSW 11 118411265 missense probably benign 0.26
R0535:Cant1 UTSW 11 118411143 missense probably damaging 1.00
R1953:Cant1 UTSW 11 118408783 missense probably damaging 1.00
R2154:Cant1 UTSW 11 118411437 missense probably damaging 1.00
R2187:Cant1 UTSW 11 118408841 nonsense probably null
R3916:Cant1 UTSW 11 118408746 missense probably damaging 0.98
R4065:Cant1 UTSW 11 118407997 missense probably benign
R4786:Cant1 UTSW 11 118408839 missense possibly damaging 0.68
R4847:Cant1 UTSW 11 118410110 nonsense probably null
R5093:Cant1 UTSW 11 118411212 missense probably damaging 1.00
R5281:Cant1 UTSW 11 118408870 missense probably damaging 0.99
R5506:Cant1 UTSW 11 118411442 missense probably benign 0.10
R5614:Cant1 UTSW 11 118408743 missense probably benign
R6705:Cant1 UTSW 11 118407872 missense probably damaging 1.00
R7538:Cant1 UTSW 11 118411465 missense possibly damaging 0.81
R7707:Cant1 UTSW 11 118410898 missense possibly damaging 0.62
R7982:Cant1 UTSW 11 118410142 missense probably benign
Predicted Primers PCR Primer
(F):5'- AGAGCCACGATGATCTGGTC -3'
(R):5'- ACTCAGTGTAGCTTTCTGGCTG -3'

Sequencing Primer
(F):5'- ATGATCTGGTCATCCGTGTTG -3'
(R):5'- GGCTGCATGGTTGTCCC -3'
Posted On2016-07-06