Incidental Mutation 'R5265:Kdm1b'
ID401670
Institutional Source Beutler Lab
Gene Symbol Kdm1b
Ensembl Gene ENSMUSG00000038080
Gene Namelysine (K)-specific demethylase 1B
Synonyms4632428N09Rik, Aof1
MMRRC Submission 042833-MU
Accession Numbers
Is this an essential gene? Possibly non essential (E-score: 0.469) question?
Stock #R5265 (G1)
Quality Score225
Status Validated
Chromosome13
Chromosomal Location47043499-47085279 bp(+) (GRCm38)
Type of Mutationmissense
DNA Base Change (assembly) A to G at 47062969 bp
ZygosityHeterozygous
Amino Acid Change Asparagine to Aspartic acid at position 272 (N272D)
Ref Sequence ENSEMBL: ENSMUSP00000038373 (fasta)
Gene Model predicted gene model for transcript(s): [ENSMUST00000037025]
Predicted Effect probably benign
Transcript: ENSMUST00000037025
AA Change: N272D

PolyPhen 2 Score 0.355 (Sensitivity: 0.90; Specificity: 0.89)
SMART Domains Protein: ENSMUSP00000038373
Gene: ENSMUSG00000038080
AA Change: N272D

DomainStartEndE-ValueType
Pfam:zf-CW 138 191 2.6e-13 PFAM
low complexity region 235 253 N/A INTRINSIC
Pfam:SWIRM 286 369 6e-12 PFAM
Pfam:Pyr_redox_2 368 490 3.1e-8 PFAM
Pfam:Thi4 375 446 2.2e-10 PFAM
Pfam:FAD_binding_3 388 423 4.1e-7 PFAM
Pfam:HI0933_like 389 428 1.6e-7 PFAM
Pfam:FAD_binding_2 390 428 1.6e-6 PFAM
Pfam:Pyr_redox 390 438 8e-8 PFAM
Pfam:NAD_binding_8 393 460 1.6e-13 PFAM
Pfam:Amino_oxidase 398 824 3.7e-86 PFAM
Predicted Effect noncoding transcript
Transcript: ENSMUST00000128977
Predicted Effect noncoding transcript
Transcript: ENSMUST00000131120
Predicted Effect probably benign
Transcript: ENSMUST00000143518
SMART Domains Protein: ENSMUSP00000114999
Gene: ENSMUSG00000038080

DomainStartEndE-ValueType
Pfam:SWIRM 3 86 1.1e-12 PFAM
Pfam:Thi4 91 163 3.5e-10 PFAM
Pfam:FAD_binding_3 105 140 3.5e-7 PFAM
Pfam:HI0933_like 106 145 1.7e-7 PFAM
Pfam:Pyr_redox_2 106 251 1.5e-10 PFAM
Pfam:FAD_binding_2 107 150 5.7e-7 PFAM
Pfam:Pyr_redox 107 158 6.4e-8 PFAM
Pfam:Pyr_redox_3 109 288 1.2e-13 PFAM
Pfam:NAD_binding_8 110 177 2.3e-13 PFAM
Pfam:Amino_oxidase 115 181 8.6e-19 PFAM
Pfam:Amino_oxidase 178 441 4.5e-63 PFAM
Meta Mutation Damage Score 0.1272 question?
Coding Region Coverage
  • 1x: 99.2%
  • 3x: 98.5%
  • 10x: 97.0%
  • 20x: 94.7%
Validation Efficiency 100% (59/59)
MGI Phenotype PHENOTYPE: Homozygous null mice of both sexes are viable, grossly normal and male mice are fertile; however, heterozygous progeny of homozygous null mothers display severe placental defects, embryonic growth impairment, neural tube defects and pericardial edema, and do not survive past E10.5. [provided by MGI curators]
Allele List at MGI
Other mutations in this stock
Total: 56 list
GeneRefVarChr/LocMutationPredicted EffectZygosity
1700017B05Rik A G 9: 57,258,894 W66R probably damaging Het
Adamts3 A G 5: 89,861,552 V84A possibly damaging Het
Caap1 C A 4: 94,501,228 E290* probably null Het
Cant1 G A 11: 118,408,050 R296C probably damaging Het
Ccdc114 T A 7: 45,947,435 D395E probably damaging Het
Cdh5 A T 8: 104,142,739 H699L probably benign Het
Cfdp1 T C 8: 111,830,985 T175A probably benign Het
Col4a4 C T 1: 82,493,591 G681E unknown Het
Comtd1 G A 14: 21,848,793 T27I probably benign Het
Copg1 T A 6: 87,892,270 V155D probably damaging Het
Dag1 A G 9: 108,207,699 Y748H possibly damaging Het
Dmwd T A 7: 19,080,281 N285K possibly damaging Het
Dsp A G 13: 38,195,183 E1968G possibly damaging Het
Ednra A G 8: 77,667,375 I364T probably damaging Het
Elovl3 C A 19: 46,134,681 T232K probably damaging Het
Ercc3 T A 18: 32,254,243 I503N probably damaging Het
Ercc6 C A 14: 32,569,623 A1008D probably benign Het
Gm10563 TTTC TTTCATTC 4: 155,614,496 probably null Het
H2-DMb2 G T 17: 34,148,562 V117F probably damaging Het
Helt A T 8: 46,292,433 W138R probably damaging Het
Itga11 A T 9: 62,737,412 H215L probably benign Het
Kcnn1 T A 8: 70,854,653 I156F probably benign Het
Kdm2b T C 5: 122,878,588 T1161A probably damaging Het
Lin54 A G 5: 100,485,519 L102P probably damaging Het
Mlh1 A C 9: 111,271,523 M1R probably null Het
Naip2 G A 13: 100,152,560 L1165F probably damaging Het
Nfkbiz A G 16: 55,819,641 S118P probably damaging Het
Nkx3-2 T A 5: 41,761,848 M266L probably benign Het
Npr1 T C 3: 90,457,002 E771G probably benign Het
Obox8 C T 7: 14,332,029 R188H probably benign Het
Olfr187 A T 16: 59,036,143 V198D possibly damaging Het
Olfr497 T A 7: 108,423,402 V277E possibly damaging Het
Palm3 T C 8: 84,021,530 probably null Het
Palmd A T 3: 116,923,849 V333D possibly damaging Het
Pikfyve A G 1: 65,267,829 E1747G possibly damaging Het
Polr3a T C 14: 24,454,941 I1084V possibly damaging Het
Ranbp3l T A 15: 9,007,203 F127I probably benign Het
Rsl1d1 A G 16: 11,201,384 F97L possibly damaging Het
Scaper A G 9: 55,864,546 V362A probably benign Het
Scg5 A T 2: 113,776,865 L192* probably null Het
Slc34a2 T C 5: 53,061,434 I198T probably damaging Het
Slc45a3 T A 1: 131,978,194 D318E possibly damaging Het
Sorl1 A G 9: 42,106,516 M105T possibly damaging Het
St3gal5 T A 6: 72,149,131 I320N probably damaging Het
Stx17 A G 4: 48,183,470 probably benign Het
Syt5 C T 7: 4,541,075 probably null Het
Thrap3 A G 4: 126,167,640 S774P probably damaging Het
Tnc A T 4: 63,993,206 M1376K probably benign Het
Tnks1bp1 T A 2: 85,062,754 D1008E probably benign Het
Trav7-1 G T 14: 52,655,304 A105S probably damaging Het
Vmn1r28 T A 6: 58,265,964 V264D probably damaging Het
Vmn1r44 T C 6: 89,893,839 V46A probably benign Het
Vmn2r10 A G 5: 108,995,720 I788T probably damaging Het
Vmn2r78 T A 7: 86,920,124 I75N probably damaging Het
Zfp821 T C 8: 109,724,359 M328T probably damaging Het
Zfp995 G A 17: 21,880,623 P210L possibly damaging Het
Other mutations in Kdm1b
AlleleSourceChrCoordTypePredicted EffectPPH Score
IGL00587:Kdm1b APN 13 47068540 missense probably benign 0.01
IGL00924:Kdm1b APN 13 47068480 missense probably benign
IGL01553:Kdm1b APN 13 47080548 missense probably damaging 0.96
IGL01663:Kdm1b APN 13 47073737 missense probably damaging 0.99
IGL02385:Kdm1b APN 13 47068506 missense possibly damaging 0.49
IGL02505:Kdm1b APN 13 47060855 missense probably damaging 1.00
IGL02826:Kdm1b APN 13 47080467 missense probably damaging 1.00
IGL03257:Kdm1b APN 13 47049266 missense probably damaging 1.00
R0052:Kdm1b UTSW 13 47064117 missense probably damaging 1.00
R0319:Kdm1b UTSW 13 47053719 missense probably benign
R0426:Kdm1b UTSW 13 47064244 splice site probably benign
R0599:Kdm1b UTSW 13 47058810 missense possibly damaging 0.47
R0764:Kdm1b UTSW 13 47068603 missense possibly damaging 0.70
R1163:Kdm1b UTSW 13 47071922 missense probably benign 0.02
R1543:Kdm1b UTSW 13 47068521 missense probably damaging 0.99
R1584:Kdm1b UTSW 13 47064054 missense probably damaging 1.00
R1627:Kdm1b UTSW 13 47064231 critical splice donor site probably null
R1669:Kdm1b UTSW 13 47068548 missense probably damaging 1.00
R1758:Kdm1b UTSW 13 47060768 missense probably benign 0.00
R1860:Kdm1b UTSW 13 47049190 missense probably benign 0.03
R1907:Kdm1b UTSW 13 47064120 missense probably benign 0.00
R2225:Kdm1b UTSW 13 47064088 frame shift probably null
R2239:Kdm1b UTSW 13 47073755 missense probably damaging 1.00
R2271:Kdm1b UTSW 13 47064088 frame shift probably null
R2302:Kdm1b UTSW 13 47064088 frame shift probably null
R2303:Kdm1b UTSW 13 47064088 frame shift probably null
R2380:Kdm1b UTSW 13 47073755 missense probably damaging 1.00
R2442:Kdm1b UTSW 13 47062975 missense probably benign 0.32
R3022:Kdm1b UTSW 13 47063077 missense probably damaging 1.00
R3054:Kdm1b UTSW 13 47063077 missense probably damaging 1.00
R3545:Kdm1b UTSW 13 47063077 missense probably damaging 1.00
R3546:Kdm1b UTSW 13 47063077 missense probably damaging 1.00
R3548:Kdm1b UTSW 13 47063077 missense probably damaging 1.00
R4094:Kdm1b UTSW 13 47063020 missense probably damaging 1.00
R4419:Kdm1b UTSW 13 47063077 missense probably damaging 1.00
R4420:Kdm1b UTSW 13 47063077 missense probably damaging 1.00
R4502:Kdm1b UTSW 13 47063077 missense probably damaging 1.00
R4547:Kdm1b UTSW 13 47063077 missense probably damaging 1.00
R4548:Kdm1b UTSW 13 47063077 missense probably damaging 1.00
R4785:Kdm1b UTSW 13 47063077 missense probably damaging 1.00
R4793:Kdm1b UTSW 13 47063077 missense probably damaging 1.00
R4804:Kdm1b UTSW 13 47063077 missense probably damaging 1.00
R4882:Kdm1b UTSW 13 47060893 missense probably benign
R4906:Kdm1b UTSW 13 47063144 critical splice donor site probably null
R4965:Kdm1b UTSW 13 47074367 missense probably damaging 0.98
R5039:Kdm1b UTSW 13 47077486 missense probably damaging 1.00
R5098:Kdm1b UTSW 13 47062991 missense probably damaging 1.00
R5541:Kdm1b UTSW 13 47079196 missense probably damaging 1.00
R5814:Kdm1b UTSW 13 47063146 splice site probably null
R6046:Kdm1b UTSW 13 47079253 missense possibly damaging 0.92
R6798:Kdm1b UTSW 13 47068536 missense probably benign 0.00
R6903:Kdm1b UTSW 13 47074404 missense probably benign 0.00
Predicted Primers PCR Primer
(F):5'- AAAGTGCCAAAGGGTGTTTG -3'
(R):5'- TTGTGTACCACAGTGCGAG -3'

Sequencing Primer
(F):5'- TCCTAGAGATTGAACTGAGGCCATC -3'
(R):5'- CACAGTGCGAGGATGAGGTTTC -3'
Posted On2016-07-06