Incidental Mutation 'R5265:Polr3a'
ID401673
Institutional Source Beutler Lab
Gene Symbol Polr3a
Ensembl Gene ENSMUSG00000025280
Gene Namepolymerase (RNA) III (DNA directed) polypeptide A
SynonymsRPC1, 9330175N20Rik, RPC155
MMRRC Submission 042833-MU
Accession Numbers
Is this an essential gene? Essential (E-score: 1.000) question?
Stock #R5265 (G1)
Quality Score225
Status Validated
Chromosome14
Chromosomal Location24448696-24487058 bp(-) (GRCm38)
Type of Mutationmissense
DNA Base Change (assembly) T to C at 24454941 bp
ZygosityHeterozygous
Amino Acid Change Isoleucine to Valine at position 1084 (I1084V)
Ref Sequence ENSEMBL: ENSMUSP00000026322 (fasta)
Gene Model predicted gene model for transcript(s): [ENSMUST00000026322] [ENSMUST00000223718]
Predicted Effect possibly damaging
Transcript: ENSMUST00000026322
AA Change: I1084V

PolyPhen 2 Score 0.648 (Sensitivity: 0.87; Specificity: 0.91)
SMART Domains Protein: ENSMUSP00000026322
Gene: ENSMUSG00000025280
AA Change: I1084V

DomainStartEndE-ValueType
Blast:RPOLA_N 122 218 5e-43 BLAST
RPOLA_N 248 553 1.09e-176 SMART
Pfam:RNA_pol_Rpb1_4 728 834 4e-35 PFAM
Pfam:RNA_pol_Rpb1_5 841 1318 1.2e-92 PFAM
Predicted Effect probably benign
Transcript: ENSMUST00000223718
Predicted Effect noncoding transcript
Transcript: ENSMUST00000223848
Meta Mutation Damage Score 0.1175 question?
Coding Region Coverage
  • 1x: 99.2%
  • 3x: 98.5%
  • 10x: 97.0%
  • 20x: 94.7%
Validation Efficiency 100% (59/59)
MGI Phenotype FUNCTION: [Summary is not available for the mouse gene. This summary is for the human ortholog.] The protein encoded by this gene is the catalytic component of RNA polymerase III, which synthesizes small RNAs. The encoded protein also acts as a sensor to detect foreign DNA and trigger an innate immune response. [provided by RefSeq, Aug 2011]
Allele List at MGI
Other mutations in this stock
Total: 56 list
GeneRefVarChr/LocMutationPredicted EffectZygosity
1700017B05Rik A G 9: 57,258,894 W66R probably damaging Het
Adamts3 A G 5: 89,861,552 V84A possibly damaging Het
Caap1 C A 4: 94,501,228 E290* probably null Het
Cant1 G A 11: 118,408,050 R296C probably damaging Het
Ccdc114 T A 7: 45,947,435 D395E probably damaging Het
Cdh5 A T 8: 104,142,739 H699L probably benign Het
Cfdp1 T C 8: 111,830,985 T175A probably benign Het
Col4a4 C T 1: 82,493,591 G681E unknown Het
Comtd1 G A 14: 21,848,793 T27I probably benign Het
Copg1 T A 6: 87,892,270 V155D probably damaging Het
Dag1 A G 9: 108,207,699 Y748H possibly damaging Het
Dmwd T A 7: 19,080,281 N285K possibly damaging Het
Dsp A G 13: 38,195,183 E1968G possibly damaging Het
Ednra A G 8: 77,667,375 I364T probably damaging Het
Elovl3 C A 19: 46,134,681 T232K probably damaging Het
Ercc3 T A 18: 32,254,243 I503N probably damaging Het
Ercc6 C A 14: 32,569,623 A1008D probably benign Het
Gm10563 TTTC TTTCATTC 4: 155,614,496 probably null Het
H2-DMb2 G T 17: 34,148,562 V117F probably damaging Het
Helt A T 8: 46,292,433 W138R probably damaging Het
Itga11 A T 9: 62,737,412 H215L probably benign Het
Kcnn1 T A 8: 70,854,653 I156F probably benign Het
Kdm1b A G 13: 47,062,969 N272D probably benign Het
Kdm2b T C 5: 122,878,588 T1161A probably damaging Het
Lin54 A G 5: 100,485,519 L102P probably damaging Het
Mlh1 A C 9: 111,271,523 M1R probably null Het
Naip2 G A 13: 100,152,560 L1165F probably damaging Het
Nfkbiz A G 16: 55,819,641 S118P probably damaging Het
Nkx3-2 T A 5: 41,761,848 M266L probably benign Het
Npr1 T C 3: 90,457,002 E771G probably benign Het
Obox8 C T 7: 14,332,029 R188H probably benign Het
Olfr187 A T 16: 59,036,143 V198D possibly damaging Het
Olfr497 T A 7: 108,423,402 V277E possibly damaging Het
Palm3 T C 8: 84,021,530 probably null Het
Palmd A T 3: 116,923,849 V333D possibly damaging Het
Pikfyve A G 1: 65,267,829 E1747G possibly damaging Het
Ranbp3l T A 15: 9,007,203 F127I probably benign Het
Rsl1d1 A G 16: 11,201,384 F97L possibly damaging Het
Scaper A G 9: 55,864,546 V362A probably benign Het
Scg5 A T 2: 113,776,865 L192* probably null Het
Slc34a2 T C 5: 53,061,434 I198T probably damaging Het
Slc45a3 T A 1: 131,978,194 D318E possibly damaging Het
Sorl1 A G 9: 42,106,516 M105T possibly damaging Het
St3gal5 T A 6: 72,149,131 I320N probably damaging Het
Stx17 A G 4: 48,183,470 probably benign Het
Syt5 C T 7: 4,541,075 probably null Het
Thrap3 A G 4: 126,167,640 S774P probably damaging Het
Tnc A T 4: 63,993,206 M1376K probably benign Het
Tnks1bp1 T A 2: 85,062,754 D1008E probably benign Het
Trav7-1 G T 14: 52,655,304 A105S probably damaging Het
Vmn1r28 T A 6: 58,265,964 V264D probably damaging Het
Vmn1r44 T C 6: 89,893,839 V46A probably benign Het
Vmn2r10 A G 5: 108,995,720 I788T probably damaging Het
Vmn2r78 T A 7: 86,920,124 I75N probably damaging Het
Zfp821 T C 8: 109,724,359 M328T probably damaging Het
Zfp995 G A 17: 21,880,623 P210L possibly damaging Het
Other mutations in Polr3a
AlleleSourceChrCoordTypePredicted EffectPPH Score
IGL00838:Polr3a APN 14 24475863 missense probably benign 0.35
IGL00974:Polr3a APN 14 24479424 missense probably benign 0.05
IGL01348:Polr3a APN 14 24461763 missense probably damaging 1.00
IGL01464:Polr3a APN 14 24470681 splice site probably benign
IGL01785:Polr3a APN 14 24484120 nonsense probably null
IGL01786:Polr3a APN 14 24484120 nonsense probably null
IGL01936:Polr3a APN 14 24479188 missense probably damaging 1.00
IGL02095:Polr3a APN 14 24454610 missense possibly damaging 0.91
IGL02454:Polr3a APN 14 24475823 missense possibly damaging 0.87
IGL02702:Polr3a APN 14 24470877 missense probably benign 0.07
IGL02961:Polr3a APN 14 24467040 nonsense probably null
IGL03069:Polr3a APN 14 24461740 missense probably damaging 0.99
R0001:Polr3a UTSW 14 24452189 splice site probably benign
R0048:Polr3a UTSW 14 24469255 splice site probably benign
R0157:Polr3a UTSW 14 24479186 missense probably damaging 0.99
R0445:Polr3a UTSW 14 24454921 missense probably benign 0.00
R0449:Polr3a UTSW 14 24484466 missense probably damaging 0.99
R0597:Polr3a UTSW 14 24484134 missense probably benign 0.29
R0604:Polr3a UTSW 14 24484164 missense probably damaging 1.00
R0644:Polr3a UTSW 14 24484164 missense probably damaging 1.00
R0703:Polr3a UTSW 14 24484164 missense probably damaging 1.00
R0754:Polr3a UTSW 14 24484164 missense probably damaging 1.00
R0767:Polr3a UTSW 14 24484164 missense probably damaging 1.00
R0816:Polr3a UTSW 14 24484164 missense probably damaging 1.00
R0817:Polr3a UTSW 14 24484164 missense probably damaging 1.00
R0819:Polr3a UTSW 14 24484164 missense probably damaging 1.00
R0840:Polr3a UTSW 14 24452200 missense possibly damaging 0.95
R1481:Polr3a UTSW 14 24452548 missense probably null 0.98
R1644:Polr3a UTSW 14 24470624 missense probably damaging 1.00
R1699:Polr3a UTSW 14 24484164 missense probably damaging 1.00
R1704:Polr3a UTSW 14 24484120 nonsense probably null
R2363:Polr3a UTSW 14 24475892 splice site probably null
R3419:Polr3a UTSW 14 24467035 missense probably damaging 1.00
R3934:Polr3a UTSW 14 24476101 missense probably benign 0.30
R4296:Polr3a UTSW 14 24453196 missense possibly damaging 0.82
R4611:Polr3a UTSW 14 24452508 splice site probably null
R4690:Polr3a UTSW 14 24464281 missense possibly damaging 0.78
R4934:Polr3a UTSW 14 24452624 missense probably benign 0.11
R4947:Polr3a UTSW 14 24482464 missense probably benign 0.00
R5232:Polr3a UTSW 14 24453211 missense probably benign 0.00
R5263:Polr3a UTSW 14 24454941 missense possibly damaging 0.65
R5264:Polr3a UTSW 14 24454941 missense possibly damaging 0.65
R5282:Polr3a UTSW 14 24454941 missense possibly damaging 0.65
R5319:Polr3a UTSW 14 24454941 missense possibly damaging 0.65
R5321:Polr3a UTSW 14 24454941 missense possibly damaging 0.65
R5323:Polr3a UTSW 14 24454941 missense possibly damaging 0.65
R5387:Polr3a UTSW 14 24454941 missense possibly damaging 0.65
R5388:Polr3a UTSW 14 24454941 missense possibly damaging 0.65
R5401:Polr3a UTSW 14 24454941 missense possibly damaging 0.65
R5402:Polr3a UTSW 14 24454941 missense possibly damaging 0.65
R5443:Polr3a UTSW 14 24454941 missense possibly damaging 0.65
R5444:Polr3a UTSW 14 24454941 missense possibly damaging 0.65
R5725:Polr3a UTSW 14 24465387 splice site probably null
R5841:Polr3a UTSW 14 24450698 missense probably benign 0.00
R6408:Polr3a UTSW 14 24486871 critical splice donor site probably null
R6704:Polr3a UTSW 14 24461842 missense probably damaging 1.00
R7136:Polr3a UTSW 14 24461815 missense probably damaging 1.00
R7307:Polr3a UTSW 14 24459987 missense probably benign 0.03
R7368:Polr3a UTSW 14 24467076 missense probably damaging 0.98
R7800:Polr3a UTSW 14 24484387 missense probably null 0.83
Z1088:Polr3a UTSW 14 24479724 missense probably damaging 0.96
Predicted Primers PCR Primer
(F):5'- CATTACCCGCACTGTCATGG -3'
(R):5'- TCTCAGTGAGAGGTCTGTGACG -3'

Sequencing Primer
(F):5'- GCTGCAGGCTACATCCACAG -3'
(R):5'- AGAGGTCTGTGACGTCCCTTG -3'
Posted On2016-07-06