Mutagenetix > Incidental Mutation

Incidental Mutation 'R5265:Polr3a'

401673

Institutional Source

Beutler Lab

Gene Symbol

Polr3a

Ensembl Gene

ENSMUSG00000025280

Gene Name

polymerase (RNA) III (DNA directed) polypeptide A

Synonyms

RPC1, 9330175N20Rik, RPC155

MMRRC Submission

042833-MU

Accession Numbers

Essential gene?

Essential (E-score: 1.000) question?

Stock #

R5265 (G1)

Quality Score

225

Status

Validated

Chromosome

Chromosomal Location

24448696-24487058 bp(-) (GRCm38)

Type of Mutation

missense

DNA Base Change (assembly)

T to C at 24454941 bp (GRCm38)

Zygosity

Heterozygous

Amino Acid Change

Isoleucine to Valine at position 1084 (I1084V)

Ref Sequence

ENSEMBL: ENSMUSP00000026322 (fasta)

Gene Model

predicted gene model for transcript(s): [ENSMUST00000026322] [ENSMUST00000223718]

AlphaFold

B2RXC6

Predicted Effect

possibly damaging
Transcript: ENSMUST00000026322
AA Change: I1084V

PolyPhen 2 Score 0.648 (Sensitivity: 0.87; Specificity: 0.91)

SMART Domains

Protein: ENSMUSP00000026322
Gene: ENSMUSG00000025280
AA Change: I1084V

Domain	Start	End	E-Value	Type
Blast:RPOLA_N	122	218	5e-43	BLAST
RPOLA_N	248	553	1.09e-176	SMART
Pfam:RNA_pol_Rpb1_4	728	834	4e-35	PFAM
Pfam:RNA_pol_Rpb1_5	841	1318	1.2e-92	PFAM

Predicted Effect

probably benign
Transcript: ENSMUST00000223718

Predicted Effect

noncoding transcript
Transcript: ENSMUST00000223848

Meta Mutation Damage Score

0.1175

Coding Region Coverage

1x: 99.2%
3x: 98.5%
10x: 97.0%
20x: 94.7%

Validation Efficiency

100% (59/59)

MGI Phenotype

FUNCTION: [Summary is not available for the mouse gene. This summary is for the human ortholog.] The protein encoded by this gene is the catalytic component of RNA polymerase III, which synthesizes small RNAs. The encoded protein also acts as a sensor to detect foreign DNA and trigger an innate immune response. [provided by RefSeq, Aug 2011]

Allele List at MGI

Other mutations in this stock

Total: 56 list
Gene	Ref	Var	Chr/Loc	Mutation	Predicted Effect	Zygosity
1700017B05Rik	A	G	9: 57,258,894	W66R	probably damaging	Het
Adamts3	A	G	5: 89,861,552	V84A	possibly damaging	Het
Caap1	C	A	4: 94,501,228	E290*	probably null	Het
Cant1	G	A	11: 118,408,050	R296C	probably damaging	Het
Ccdc114	T	A	7: 45,947,435	D395E	probably damaging	Het
Cdh5	A	T	8: 104,142,739	H699L	probably benign	Het
Cfdp1	T	C	8: 111,830,985	T175A	probably benign	Het
Col4a4	C	T	1: 82,493,591	G681E	unknown	Het
Comtd1	G	A	14: 21,848,793	T27I	probably benign	Het
Copg1	T	A	6: 87,892,270	V155D	probably damaging	Het
Dag1	A	G	9: 108,207,699	Y748H	possibly damaging	Het
Dmwd	T	A	7: 19,080,281	N285K	possibly damaging	Het
Dsp	A	G	13: 38,195,183	E1968G	possibly damaging	Het
Ednra	A	G	8: 77,667,375	I364T	probably damaging	Het
Elovl3	C	A	19: 46,134,681	T232K	probably damaging	Het
Ercc3	T	A	18: 32,254,243	I503N	probably damaging	Het
Ercc6	C	A	14: 32,569,623	A1008D	probably benign	Het
Gm10563	TTTC	TTTCATTC	4: 155,614,496		probably null	Het
H2-DMb2	G	T	17: 34,148,562	V117F	probably damaging	Het
Helt	A	T	8: 46,292,433	W138R	probably damaging	Het
Itga11	A	T	9: 62,737,412	H215L	probably benign	Het
Kcnn1	T	A	8: 70,854,653	I156F	probably benign	Het
Kdm1b	A	G	13: 47,062,969	N272D	probably benign	Het
Kdm2b	T	C	5: 122,878,588	T1161A	probably damaging	Het
Lin54	A	G	5: 100,485,519	L102P	probably damaging	Het
Mlh1	A	C	9: 111,271,523	M1R	probably null	Het
Naip2	G	A	13: 100,152,560	L1165F	probably damaging	Het
Nfkbiz	A	G	16: 55,819,641	S118P	probably damaging	Het
Nkx3-2	T	A	5: 41,761,848	M266L	probably benign	Het
Npr1	T	C	3: 90,457,002	E771G	probably benign	Het
Obox8	C	T	7: 14,332,029	R188H	probably benign	Het
Olfr187	A	T	16: 59,036,143	V198D	possibly damaging	Het
Olfr497	T	A	7: 108,423,402	V277E	possibly damaging	Het
Palm3	T	C	8: 84,021,530		probably null	Het
Palmd	A	T	3: 116,923,849	V333D	possibly damaging	Het
Pikfyve	A	G	1: 65,267,829	E1747G	possibly damaging	Het
Ranbp3l	T	A	15: 9,007,203	F127I	probably benign	Het
Rsl1d1	A	G	16: 11,201,384	F97L	possibly damaging	Het
Scaper	A	G	9: 55,864,546	V362A	probably benign	Het
Scg5	A	T	2: 113,776,865	L192*	probably null	Het
Slc34a2	T	C	5: 53,061,434	I198T	probably damaging	Het
Slc45a3	T	A	1: 131,978,194	D318E	possibly damaging	Het
Sorl1	A	G	9: 42,106,516	M105T	possibly damaging	Het
St3gal5	T	A	6: 72,149,131	I320N	probably damaging	Het
Stx17	A	G	4: 48,183,470		probably benign	Het
Syt5	C	T	7: 4,541,075		probably null	Het
Thrap3	A	G	4: 126,167,640	S774P	probably damaging	Het
Tnc	A	T	4: 63,993,206	M1376K	probably benign	Het
Tnks1bp1	T	A	2: 85,062,754	D1008E	probably benign	Het
Trav7-1	G	T	14: 52,655,304	A105S	probably damaging	Het
Vmn1r28	T	A	6: 58,265,964	V264D	probably damaging	Het
Vmn1r44	T	C	6: 89,893,839	V46A	probably benign	Het
Vmn2r10	A	G	5: 108,995,720	I788T	probably damaging	Het
Vmn2r78	T	A	7: 86,920,124	I75N	probably damaging	Het
Zfp821	T	C	8: 109,724,359	M328T	probably damaging	Het
Zfp995	G	A	17: 21,880,623	P210L	possibly damaging	Het

Other mutations in Polr3a

Allele	Source	Chr	Coord	Type	Predicted Effect	PPH Score
IGL00838:Polr3a	APN	14	24475863	missense	probably benign	0.35
IGL00974:Polr3a	APN	14	24479424	missense	probably benign	0.05
IGL01348:Polr3a	APN	14	24461763	missense	probably damaging	1.00
IGL01464:Polr3a	APN	14	24470681	splice site	probably benign
IGL01785:Polr3a	APN	14	24484120	nonsense	probably null
IGL01786:Polr3a	APN	14	24484120	nonsense	probably null
IGL01936:Polr3a	APN	14	24479188	missense	probably damaging	1.00
IGL02095:Polr3a	APN	14	24454610	missense	possibly damaging	0.91
IGL02454:Polr3a	APN	14	24475823	missense	possibly damaging	0.87
IGL02702:Polr3a	APN	14	24470877	missense	probably benign	0.07
IGL02961:Polr3a	APN	14	24467040	nonsense	probably null
IGL03069:Polr3a	APN	14	24461740	missense	probably damaging	0.99
R0001:Polr3a	UTSW	14	24452189	splice site	probably benign
R0048:Polr3a	UTSW	14	24469255	splice site	probably benign
R0157:Polr3a	UTSW	14	24479186	missense	probably damaging	0.99
R0445:Polr3a	UTSW	14	24454921	missense	probably benign	0.00
R0449:Polr3a	UTSW	14	24484466	missense	probably damaging	0.99
R0597:Polr3a	UTSW	14	24484134	missense	probably benign	0.29
R0604:Polr3a	UTSW	14	24484164	missense	probably damaging	1.00
R0644:Polr3a	UTSW	14	24484164	missense	probably damaging	1.00
R0703:Polr3a	UTSW	14	24484164	missense	probably damaging	1.00
R0754:Polr3a	UTSW	14	24484164	missense	probably damaging	1.00
R0767:Polr3a	UTSW	14	24484164	missense	probably damaging	1.00
R0816:Polr3a	UTSW	14	24484164	missense	probably damaging	1.00
R0817:Polr3a	UTSW	14	24484164	missense	probably damaging	1.00
R0819:Polr3a	UTSW	14	24484164	missense	probably damaging	1.00
R0840:Polr3a	UTSW	14	24452200	missense	possibly damaging	0.95
R1481:Polr3a	UTSW	14	24452548	missense	probably null	0.98
R1644:Polr3a	UTSW	14	24470624	missense	probably damaging	1.00
R1699:Polr3a	UTSW	14	24484164	missense	probably damaging	1.00
R1704:Polr3a	UTSW	14	24484120	nonsense	probably null
R2363:Polr3a	UTSW	14	24475892	splice site	probably null
R3419:Polr3a	UTSW	14	24467035	missense	probably damaging	1.00
R3934:Polr3a	UTSW	14	24476101	missense	probably benign	0.30
R4296:Polr3a	UTSW	14	24453196	missense	possibly damaging	0.82
R4611:Polr3a	UTSW	14	24452508	splice site	probably null
R4690:Polr3a	UTSW	14	24464281	missense	possibly damaging	0.78
R4934:Polr3a	UTSW	14	24452624	missense	probably benign	0.11
R4947:Polr3a	UTSW	14	24482464	missense	probably benign	0.00
R5232:Polr3a	UTSW	14	24453211	missense	probably benign	0.00
R5263:Polr3a	UTSW	14	24454941	missense	possibly damaging	0.65
R5264:Polr3a	UTSW	14	24454941	missense	possibly damaging	0.65
R5282:Polr3a	UTSW	14	24454941	missense	possibly damaging	0.65
R5319:Polr3a	UTSW	14	24454941	missense	possibly damaging	0.65
R5321:Polr3a	UTSW	14	24454941	missense	possibly damaging	0.65
R5323:Polr3a	UTSW	14	24454941	missense	possibly damaging	0.65
R5387:Polr3a	UTSW	14	24454941	missense	possibly damaging	0.65
R5388:Polr3a	UTSW	14	24454941	missense	possibly damaging	0.65
R5401:Polr3a	UTSW	14	24454941	missense	possibly damaging	0.65
R5402:Polr3a	UTSW	14	24454941	missense	possibly damaging	0.65
R5443:Polr3a	UTSW	14	24454941	missense	possibly damaging	0.65
R5444:Polr3a	UTSW	14	24454941	missense	possibly damaging	0.65
R5725:Polr3a	UTSW	14	24465387	splice site	probably null
R5841:Polr3a	UTSW	14	24450698	missense	probably benign	0.00
R6408:Polr3a	UTSW	14	24486871	critical splice donor site	probably null
R6704:Polr3a	UTSW	14	24461842	missense	probably damaging	1.00
R7136:Polr3a	UTSW	14	24461815	missense	probably damaging	1.00
R7307:Polr3a	UTSW	14	24459987	missense	probably benign	0.03
R7368:Polr3a	UTSW	14	24467076	missense	probably damaging	0.98
R7800:Polr3a	UTSW	14	24484387	missense	probably null	0.83
R8753:Polr3a	UTSW	14	24463634	nonsense	probably null
R8785:Polr3a	UTSW	14	24452315	missense	probably benign	0.06
R8848:Polr3a	UTSW	14	24450766	missense	probably damaging	1.00
R9025:Polr3a	UTSW	14	24469411	missense	probably damaging	1.00
R9139:Polr3a	UTSW	14	24469348	missense	probably damaging	1.00
R9264:Polr3a	UTSW	14	24470831	missense	probably benign
R9309:Polr3a	UTSW	14	24459999	missense	probably benign
R9363:Polr3a	UTSW	14	24450763	missense	probably damaging	1.00
R9526:Polr3a	UTSW	14	24453245	missense	probably benign	0.00
R9585:Polr3a	UTSW	14	24452221	missense	probably damaging	1.00
Z1088:Polr3a	UTSW	14	24479724	missense	probably damaging	0.96

Predicted Primers

PCR Primer
(F):5'- CATTACCCGCACTGTCATGG -3'
(R):5'- TCTCAGTGAGAGGTCTGTGACG -3'

Sequencing Primer
(F):5'- GCTGCAGGCTACATCCACAG -3'
(R):5'- AGAGGTCTGTGACGTCCCTTG -3'

Posted On

2016-07-06