Mutagenetix > Incidental Mutation

Incidental Mutation 'R5265:Ercc6'

401674

Institutional Source

Beutler Lab

Gene Symbol

Ercc6

Ensembl Gene

ENSMUSG00000054051

Gene Name

excision repair cross-complementing rodent repair deficiency, complementation group 6

Synonyms

CS group B correcting gene, C130058G22Rik, CSB

MMRRC Submission

042833-MU

Accession Numbers

Essential gene?

Possibly non essential (E-score: 0.495) question?

Stock #

R5265 (G1)

Quality Score

225

Status

Validated

Chromosome

Chromosomal Location

32513521-32580990 bp(+) (GRCm38)

Type of Mutation

missense

DNA Base Change (assembly)

C to A at 32569623 bp (GRCm38)

Zygosity

Heterozygous

Amino Acid Change

Alanine to Aspartic acid at position 1008 (A1008D)

Ref Sequence

ENSEMBL: ENSMUSP00000066256 (fasta)

Gene Model

predicted gene model for transcript(s): [ENSMUST00000066807]

AlphaFold

F8VPZ5

Predicted Effect

probably benign
Transcript: ENSMUST00000066807
AA Change: A1008D

PolyPhen 2 Score 0.009 (Sensitivity: 0.96; Specificity: 0.77)

SMART Domains

Protein: ENSMUSP00000066256
Gene: ENSMUSG00000054051
AA Change: A1008D

Domain	Start	End	E-Value	Type
PDB:4CVO\|A	82	160	1e-36	PDB
low complexity region	286	299	N/A	INTRINSIC
low complexity region	361	390	N/A	INTRINSIC
low complexity region	422	434	N/A	INTRINSIC
low complexity region	460	469	N/A	INTRINSIC
low complexity region	479	491	N/A	INTRINSIC
DEXDc	499	699	8.34e-33	SMART
Blast:DEXDc	720	821	7e-56	BLAST
HELICc	865	948	1.41e-21	SMART
low complexity region	1364	1377	N/A	INTRINSIC

Predicted Effect

probably benign
Transcript: ENSMUST00000228549

Meta Mutation Damage Score

0.0898

Coding Region Coverage

1x: 99.2%
3x: 98.5%
10x: 97.0%
20x: 94.7%

Validation Efficiency

100% (59/59)

MGI Phenotype

FUNCTION: [Summary is not available for the mouse gene. This summary is for the human ortholog.] This gene encodes a DNA-binding protein that is important in transcription-coupled excision repair. The encoded protein has ATP-stimulated ATPase activity, interacts with several transcription and excision repair proteins, and may promote complex formation at DNA repair sites. Mutations in this gene are associated with Cockayne syndrome type B and cerebrooculofacioskeletal syndrome 1. Alternative splicing occurs between a splice site from exon 5 of this gene to the 3' splice site upstream of the open reading frame (ORF) of the adjacent gene, piggyback-derived-3 (GeneID:267004), which activates the alternative polyadenylation site downstream of the piggyback-derived-3 ORF. The resulting transcripts encode a fusion protein that shares sequence with the product of each individual gene. [provided by RefSeq, Mar 2016]
PHENOTYPE: Homozygous mutant mice exhibit UV sensitivity, inactivation of transcription-coupled repair, increased incidence of induced skin and eye tumors, circling behavior, impaired coordination and lower body weight. [provided by MGI curators]

Allele List at MGI

Other mutations in this stock

Total: 56 list
Gene	Ref	Var	Chr/Loc	Mutation	Predicted Effect	Zygosity
1700017B05Rik	A	G	9: 57,258,894	W66R	probably damaging	Het
Adamts3	A	G	5: 89,861,552	V84A	possibly damaging	Het
Caap1	C	A	4: 94,501,228	E290*	probably null	Het
Cant1	G	A	11: 118,408,050	R296C	probably damaging	Het
Ccdc114	T	A	7: 45,947,435	D395E	probably damaging	Het
Cdh5	A	T	8: 104,142,739	H699L	probably benign	Het
Cfdp1	T	C	8: 111,830,985	T175A	probably benign	Het
Col4a4	C	T	1: 82,493,591	G681E	unknown	Het
Comtd1	G	A	14: 21,848,793	T27I	probably benign	Het
Copg1	T	A	6: 87,892,270	V155D	probably damaging	Het
Dag1	A	G	9: 108,207,699	Y748H	possibly damaging	Het
Dmwd	T	A	7: 19,080,281	N285K	possibly damaging	Het
Dsp	A	G	13: 38,195,183	E1968G	possibly damaging	Het
Ednra	A	G	8: 77,667,375	I364T	probably damaging	Het
Elovl3	C	A	19: 46,134,681	T232K	probably damaging	Het
Ercc3	T	A	18: 32,254,243	I503N	probably damaging	Het
Gm10563	TTTC	TTTCATTC	4: 155,614,496		probably null	Het
H2-DMb2	G	T	17: 34,148,562	V117F	probably damaging	Het
Helt	A	T	8: 46,292,433	W138R	probably damaging	Het
Itga11	A	T	9: 62,737,412	H215L	probably benign	Het
Kcnn1	T	A	8: 70,854,653	I156F	probably benign	Het
Kdm1b	A	G	13: 47,062,969	N272D	probably benign	Het
Kdm2b	T	C	5: 122,878,588	T1161A	probably damaging	Het
Lin54	A	G	5: 100,485,519	L102P	probably damaging	Het
Mlh1	A	C	9: 111,271,523	M1R	probably null	Het
Naip2	G	A	13: 100,152,560	L1165F	probably damaging	Het
Nfkbiz	A	G	16: 55,819,641	S118P	probably damaging	Het
Nkx3-2	T	A	5: 41,761,848	M266L	probably benign	Het
Npr1	T	C	3: 90,457,002	E771G	probably benign	Het
Obox8	C	T	7: 14,332,029	R188H	probably benign	Het
Olfr187	A	T	16: 59,036,143	V198D	possibly damaging	Het
Olfr497	T	A	7: 108,423,402	V277E	possibly damaging	Het
Palm3	T	C	8: 84,021,530		probably null	Het
Palmd	A	T	3: 116,923,849	V333D	possibly damaging	Het
Pikfyve	A	G	1: 65,267,829	E1747G	possibly damaging	Het
Polr3a	T	C	14: 24,454,941	I1084V	possibly damaging	Het
Ranbp3l	T	A	15: 9,007,203	F127I	probably benign	Het
Rsl1d1	A	G	16: 11,201,384	F97L	possibly damaging	Het
Scaper	A	G	9: 55,864,546	V362A	probably benign	Het
Scg5	A	T	2: 113,776,865	L192*	probably null	Het
Slc34a2	T	C	5: 53,061,434	I198T	probably damaging	Het
Slc45a3	T	A	1: 131,978,194	D318E	possibly damaging	Het
Sorl1	A	G	9: 42,106,516	M105T	possibly damaging	Het
St3gal5	T	A	6: 72,149,131	I320N	probably damaging	Het
Stx17	A	G	4: 48,183,470		probably benign	Het
Syt5	C	T	7: 4,541,075		probably null	Het
Thrap3	A	G	4: 126,167,640	S774P	probably damaging	Het
Tnc	A	T	4: 63,993,206	M1376K	probably benign	Het
Tnks1bp1	T	A	2: 85,062,754	D1008E	probably benign	Het
Trav7-1	G	T	14: 52,655,304	A105S	probably damaging	Het
Vmn1r28	T	A	6: 58,265,964	V264D	probably damaging	Het
Vmn1r44	T	C	6: 89,893,839	V46A	probably benign	Het
Vmn2r10	A	G	5: 108,995,720	I788T	probably damaging	Het
Vmn2r78	T	A	7: 86,920,124	I75N	probably damaging	Het
Zfp821	T	C	8: 109,724,359	M328T	probably damaging	Het
Zfp995	G	A	17: 21,880,623	P210L	possibly damaging	Het

Other mutations in Ercc6

Allele	Source	Chr	Coord	Type	Predicted Effect	PPH Score
IGL00321:Ercc6	APN	14	32568072	missense	probably damaging	1.00
IGL00796:Ercc6	APN	14	32570002	missense	probably benign	0.01
IGL00916:Ercc6	APN	14	32562655	intron	probably benign
IGL01743:Ercc6	APN	14	32552604	missense	probably damaging	1.00
IGL01802:Ercc6	APN	14	32562574	missense	probably damaging	0.99
IGL01886:Ercc6	APN	14	32569580	missense	possibly damaging	0.90
IGL02100:Ercc6	APN	14	32517095	missense	probably benign	0.00
IGL02115:Ercc6	APN	14	32576993	missense	probably damaging	1.00
IGL02755:Ercc6	APN	14	32575748	splice site	probably benign
IGL02964:Ercc6	APN	14	32570103	missense	probably benign	0.00
IGL02998:Ercc6	APN	14	32557857	missense	probably benign	0.05
IGL03150:Ercc6	APN	14	32558574	missense	probably damaging	0.96
R0152:Ercc6	UTSW	14	32546905	critical splice donor site	probably benign
R0519:Ercc6	UTSW	14	32526842	missense	probably damaging	1.00
R0591:Ercc6	UTSW	14	32558016	splice site	probably benign
R0894:Ercc6	UTSW	14	32517028	missense	probably benign	0.05
R0946:Ercc6	UTSW	14	32552621	missense	probably benign	0.08
R1313:Ercc6	UTSW	14	32552720	splice site	probably benign
R1506:Ercc6	UTSW	14	32569864	missense	probably benign	0.01
R1528:Ercc6	UTSW	14	32519022	missense	probably damaging	0.98
R1711:Ercc6	UTSW	14	32526176	missense	probably damaging	1.00
R1753:Ercc6	UTSW	14	32576999	missense	probably benign
R1795:Ercc6	UTSW	14	32517028	missense	probably benign	0.05
R1843:Ercc6	UTSW	14	32546820	missense	probably damaging	0.99
R1853:Ercc6	UTSW	14	32576816	missense	possibly damaging	0.86
R1859:Ercc6	UTSW	14	32526778	missense	probably damaging	1.00
R1912:Ercc6	UTSW	14	32576803	missense	probably damaging	1.00
R2308:Ercc6	UTSW	14	32566409	missense	possibly damaging	0.70
R2322:Ercc6	UTSW	14	32526317	missense	probably damaging	1.00
R2386:Ercc6	UTSW	14	32541359	splice site	probably null
R4170:Ercc6	UTSW	14	32566797	missense	probably damaging	1.00
R4369:Ercc6	UTSW	14	32517207	missense	probably damaging	0.96
R4389:Ercc6	UTSW	14	32574908	nonsense	probably null
R4747:Ercc6	UTSW	14	32569907	missense	probably benign	0.00
R4811:Ercc6	UTSW	14	32574929	missense	probably benign	0.20
R4840:Ercc6	UTSW	14	32541296	missense	probably damaging	1.00
R4973:Ercc6	UTSW	14	32574902	missense	probably damaging	1.00
R5068:Ercc6	UTSW	14	32570063	missense	probably benign	0.01
R5069:Ercc6	UTSW	14	32570063	missense	probably benign	0.01
R5070:Ercc6	UTSW	14	32570063	missense	probably benign	0.01
R5093:Ercc6	UTSW	14	32567522	missense	probably damaging	1.00
R5272:Ercc6	UTSW	14	32519028	nonsense	probably null
R5499:Ercc6	UTSW	14	32516959	start codon destroyed	probably null	0.98
R5795:Ercc6	UTSW	14	32526352	missense	probably damaging	0.98
R6258:Ercc6	UTSW	14	32557856	missense	probably benign	0.00
R6260:Ercc6	UTSW	14	32557856	missense	probably benign	0.00
R6267:Ercc6	UTSW	14	32526403	nonsense	probably null
R6291:Ercc6	UTSW	14	32569986	missense	probably benign	0.01
R6296:Ercc6	UTSW	14	32526403	nonsense	probably null
R6361:Ercc6	UTSW	14	32517110	missense	probably benign	0.00
R6500:Ercc6	UTSW	14	32526823	missense	probably damaging	0.96
R6555:Ercc6	UTSW	14	32517107	missense	probably benign	0.15
R6724:Ercc6	UTSW	14	32566331	missense	probably benign	0.01
R6925:Ercc6	UTSW	14	32562608	missense	probably damaging	0.99
R7143:Ercc6	UTSW	14	32570305	missense	probably damaging	1.00
R7327:Ercc6	UTSW	14	32526404	missense	probably benign	0.19
R7396:Ercc6	UTSW	14	32569805	missense	probably benign	0.00
R7529:Ercc6	UTSW	14	32560729	nonsense	probably null
R7609:Ercc6	UTSW	14	32566361	missense	probably benign	0.11
R7802:Ercc6	UTSW	14	32517303	missense	probably damaging	1.00
R7854:Ercc6	UTSW	14	32566292	missense	probably damaging	1.00
R7995:Ercc6	UTSW	14	32562569	missense	probably damaging	0.99
R8181:Ercc6	UTSW	14	32557948	missense	probably damaging	1.00
R8320:Ercc6	UTSW	14	32521015	missense	probably benign	0.01
R8388:Ercc6	UTSW	14	32570340	utr 3 prime	probably benign
R8479:Ercc6	UTSW	14	32526406	missense	probably benign	0.00
R8831:Ercc6	UTSW	14	32560827	critical splice donor site	probably null
R8849:Ercc6	UTSW	14	32569608	missense	probably damaging	1.00
R8912:Ercc6	UTSW	14	32526254	missense	probably benign	0.40
R9210:Ercc6	UTSW	14	32569865	missense	probably benign	0.00
R9309:Ercc6	UTSW	14	32518947	missense	probably damaging	1.00
R9499:Ercc6	UTSW	14	32562568	missense	probably damaging	1.00
R9552:Ercc6	UTSW	14	32562568	missense	probably damaging	1.00
R9562:Ercc6	UTSW	14	32574967	missense	probably damaging	1.00
R9688:Ercc6	UTSW	14	32575798	missense	probably benign
R9699:Ercc6	UTSW	14	32560746	missense	probably damaging	1.00
R9743:Ercc6	UTSW	14	32576986	missense	probably benign	0.01
Z1176:Ercc6	UTSW	14	32526487	missense	probably benign	0.27

Predicted Primers

PCR Primer
(F):5'- ATTTCCCATGGCTGAAGGTTTG -3'
(R):5'- GATCTGTTCCCAGGACTGTG -3'

Sequencing Primer
(F):5'- GCTGGAAATTGAACCCAGGTCTTC -3'
(R):5'- CCGTTCCTGTAATAGGGA -3'

Posted On

2016-07-06