Mutagenetix > Incidental Mutation

Incidental Mutation 'R5265:Nfkbiz'

401677

Institutional Source

Beutler Lab

Gene Symbol

Nfkbiz

Ensembl Gene

ENSMUSG00000035356

Gene Name

nuclear factor of kappa light polypeptide gene enhancer in B cells inhibitor, zeta

Synonyms

Mail

MMRRC Submission

042833-MU

Accession Numbers

Essential gene?

Possibly essential (E-score: 0.690) question?

Stock #

R5265 (G1)

Quality Score

225

Status

Validated

Chromosome

Chromosomal Location

55811375-55838899 bp(-) (GRCm38)

Type of Mutation

missense

DNA Base Change (assembly)

A to G at 55819641 bp (GRCm38)

Zygosity

Heterozygous

Amino Acid Change

Serine to Proline at position 118 (S118P)

Ref Sequence

ENSEMBL: ENSMUSP00000110102 (fasta)

Gene Model

predicted gene model for transcript(s): [ENSMUST00000036273] [ENSMUST00000096026] [ENSMUST00000114457] [ENSMUST00000114458]

AlphaFold

Q9EST8

Predicted Effect

probably damaging
Transcript: ENSMUST00000036273
AA Change: S118P

PolyPhen 2 Score 1.000 (Sensitivity: 0.00; Specificity: 1.00)

SMART Domains

Protein: ENSMUSP00000041173
Gene: ENSMUSG00000035356
AA Change: S118P

Domain	Start	End	E-Value	Type
low complexity region	53	83	N/A	INTRINSIC
low complexity region	289	315	N/A	INTRINSIC
ANK	453	482	1.29e2	SMART
ANK	489	518	4.93e0	SMART
ANK	522	551	1.63e0	SMART
ANK	561	591	7.89e1	SMART
ANK	622	651	1.17e-1	SMART
ANK	658	691	2.92e-2	SMART

Predicted Effect

probably damaging
Transcript: ENSMUST00000096026
AA Change: S19P

PolyPhen 2 Score 1.000 (Sensitivity: 0.00; Specificity: 1.00)

SMART Domains

Protein: ENSMUSP00000093726
Gene: ENSMUSG00000035356
AA Change: S19P

Domain	Start	End	E-Value	Type
low complexity region	190	216	N/A	INTRINSIC
ANK	354	383	1.29e2	SMART
ANK	390	419	4.93e0	SMART
ANK	423	452	1.63e0	SMART
ANK	462	492	7.89e1	SMART
ANK	523	552	1.17e-1	SMART
ANK	559	592	2.92e-2	SMART

Predicted Effect

probably damaging
Transcript: ENSMUST00000114457
AA Change: S19P

PolyPhen 2 Score 1.000 (Sensitivity: 0.00; Specificity: 1.00)

SMART Domains

Protein: ENSMUSP00000110101
Gene: ENSMUSG00000035356
AA Change: S19P

Domain	Start	End	E-Value	Type
low complexity region	190	216	N/A	INTRINSIC
ANK	354	383	1.29e2	SMART
ANK	390	419	4.93e0	SMART
ANK	423	452	1.63e0	SMART
ANK	462	492	7.89e1	SMART
ANK	523	552	1.17e-1	SMART
ANK	559	592	2.92e-2	SMART

Predicted Effect

probably damaging
Transcript: ENSMUST00000114458
AA Change: S118P

PolyPhen 2 Score 1.000 (Sensitivity: 0.00; Specificity: 1.00)

SMART Domains

Protein: ENSMUSP00000110102
Gene: ENSMUSG00000035356
AA Change: S118P

Domain	Start	End	E-Value	Type
low complexity region	53	83	N/A	INTRINSIC
low complexity region	289	315	N/A	INTRINSIC
ANK	453	482	1.29e2	SMART
ANK	489	518	4.93e0	SMART
ANK	522	551	1.63e0	SMART
ANK	561	591	7.89e1	SMART
ANK	622	651	1.17e-1	SMART
ANK	658	691	2.92e-2	SMART

Predicted Effect

noncoding transcript
Transcript: ENSMUST00000231463

Meta Mutation Damage Score

0.0759

Coding Region Coverage

1x: 99.2%
3x: 98.5%
10x: 97.0%
20x: 94.7%

Validation Efficiency

100% (59/59)

MGI Phenotype

FUNCTION: [Summary is not available for the mouse gene. This summary is for the human ortholog.] This gene is a member of the ankyrin-repeat family and is induced by lipopolysaccharide (LPS). The C-terminal portion of the encoded product which contains the ankyrin repeats, shares high sequence similarity with the I kappa B family of proteins. The latter are known to play a role in inflammatory responses to LPS by their interaction with NF-B proteins through ankyrin-repeat domains. Studies in mouse indicate that this gene product is one of the nuclear I kappa B proteins and an activator of IL-6 production. Two transcript variants encoding different isoforms have been found for this gene. [provided by RefSeq, Jul 2008]
PHENOTYPE: Homozygous inactivation of this gene may lead to background sensitive prenatal lethality and results in abnormal cytokine secretion, higher IgE levels, ocular surface and perioral skin inflammation accompanied by hair loss, and severe atopic dermatitis-like skin lesions. [provided by MGI curators]

Allele List at MGI

Other mutations in this stock

Total: 56 list
Gene	Ref	Var	Chr/Loc	Mutation	Predicted Effect	Zygosity
1700017B05Rik	A	G	9: 57,258,894	W66R	probably damaging	Het
Adamts3	A	G	5: 89,861,552	V84A	possibly damaging	Het
Caap1	C	A	4: 94,501,228	E290*	probably null	Het
Cant1	G	A	11: 118,408,050	R296C	probably damaging	Het
Ccdc114	T	A	7: 45,947,435	D395E	probably damaging	Het
Cdh5	A	T	8: 104,142,739	H699L	probably benign	Het
Cfdp1	T	C	8: 111,830,985	T175A	probably benign	Het
Col4a4	C	T	1: 82,493,591	G681E	unknown	Het
Comtd1	G	A	14: 21,848,793	T27I	probably benign	Het
Copg1	T	A	6: 87,892,270	V155D	probably damaging	Het
Dag1	A	G	9: 108,207,699	Y748H	possibly damaging	Het
Dmwd	T	A	7: 19,080,281	N285K	possibly damaging	Het
Dsp	A	G	13: 38,195,183	E1968G	possibly damaging	Het
Ednra	A	G	8: 77,667,375	I364T	probably damaging	Het
Elovl3	C	A	19: 46,134,681	T232K	probably damaging	Het
Ercc3	T	A	18: 32,254,243	I503N	probably damaging	Het
Ercc6	C	A	14: 32,569,623	A1008D	probably benign	Het
Gm10563	TTTC	TTTCATTC	4: 155,614,496		probably null	Het
H2-DMb2	G	T	17: 34,148,562	V117F	probably damaging	Het
Helt	A	T	8: 46,292,433	W138R	probably damaging	Het
Itga11	A	T	9: 62,737,412	H215L	probably benign	Het
Kcnn1	T	A	8: 70,854,653	I156F	probably benign	Het
Kdm1b	A	G	13: 47,062,969	N272D	probably benign	Het
Kdm2b	T	C	5: 122,878,588	T1161A	probably damaging	Het
Lin54	A	G	5: 100,485,519	L102P	probably damaging	Het
Mlh1	A	C	9: 111,271,523	M1R	probably null	Het
Naip2	G	A	13: 100,152,560	L1165F	probably damaging	Het
Nkx3-2	T	A	5: 41,761,848	M266L	probably benign	Het
Npr1	T	C	3: 90,457,002	E771G	probably benign	Het
Obox8	C	T	7: 14,332,029	R188H	probably benign	Het
Olfr187	A	T	16: 59,036,143	V198D	possibly damaging	Het
Olfr497	T	A	7: 108,423,402	V277E	possibly damaging	Het
Palm3	T	C	8: 84,021,530		probably null	Het
Palmd	A	T	3: 116,923,849	V333D	possibly damaging	Het
Pikfyve	A	G	1: 65,267,829	E1747G	possibly damaging	Het
Polr3a	T	C	14: 24,454,941	I1084V	possibly damaging	Het
Ranbp3l	T	A	15: 9,007,203	F127I	probably benign	Het
Rsl1d1	A	G	16: 11,201,384	F97L	possibly damaging	Het
Scaper	A	G	9: 55,864,546	V362A	probably benign	Het
Scg5	A	T	2: 113,776,865	L192*	probably null	Het
Slc34a2	T	C	5: 53,061,434	I198T	probably damaging	Het
Slc45a3	T	A	1: 131,978,194	D318E	possibly damaging	Het
Sorl1	A	G	9: 42,106,516	M105T	possibly damaging	Het
St3gal5	T	A	6: 72,149,131	I320N	probably damaging	Het
Stx17	A	G	4: 48,183,470		probably benign	Het
Syt5	C	T	7: 4,541,075		probably null	Het
Thrap3	A	G	4: 126,167,640	S774P	probably damaging	Het
Tnc	A	T	4: 63,993,206	M1376K	probably benign	Het
Tnks1bp1	T	A	2: 85,062,754	D1008E	probably benign	Het
Trav7-1	G	T	14: 52,655,304	A105S	probably damaging	Het
Vmn1r28	T	A	6: 58,265,964	V264D	probably damaging	Het
Vmn1r44	T	C	6: 89,893,839	V46A	probably benign	Het
Vmn2r10	A	G	5: 108,995,720	I788T	probably damaging	Het
Vmn2r78	T	A	7: 86,920,124	I75N	probably damaging	Het
Zfp821	T	C	8: 109,724,359	M328T	probably damaging	Het
Zfp995	G	A	17: 21,880,623	P210L	possibly damaging	Het

Other mutations in Nfkbiz

Allele	Source	Chr	Coord	Type	Predicted Effect	PPH Score
IGL00484:Nfkbiz	APN	16	55817909	missense	probably benign
IGL01324:Nfkbiz	APN	16	55815804	missense	probably damaging	1.00
IGL02086:Nfkbiz	APN	16	55815671	missense	probably damaging	1.00
IGL02627:Nfkbiz	APN	16	55816351	missense	probably damaging	1.00
IGL02740:Nfkbiz	APN	16	55817954	missense	probably benign
R0349:Nfkbiz	UTSW	16	55818991	critical splice donor site	probably null
R0539:Nfkbiz	UTSW	16	55817879	missense	probably benign	0.08
R0827:Nfkbiz	UTSW	16	55816367	missense	probably damaging	1.00
R1403:Nfkbiz	UTSW	16	55816470	splice site	probably benign
R1743:Nfkbiz	UTSW	16	55816394	missense	possibly damaging	0.82
R2090:Nfkbiz	UTSW	16	55816455	missense	probably benign	0.01
R2163:Nfkbiz	UTSW	16	55818218	missense	probably benign	0.00
R3195:Nfkbiz	UTSW	16	55819628	missense	probably damaging	1.00
R3974:Nfkbiz	UTSW	16	55818436	missense	probably benign	0.42
R4513:Nfkbiz	UTSW	16	55816841	missense	probably benign	0.20
R4765:Nfkbiz	UTSW	16	55819024	critical splice acceptor site	probably null
R4864:Nfkbiz	UTSW	16	55818424	missense	probably damaging	1.00
R5134:Nfkbiz	UTSW	16	55818500	missense	probably damaging	1.00
R5510:Nfkbiz	UTSW	16	55814020	missense	probably damaging	1.00
R6327:Nfkbiz	UTSW	16	55821962	missense	probably damaging	1.00
R7083:Nfkbiz	UTSW	16	55818300	missense	possibly damaging	0.88
R7369:Nfkbiz	UTSW	16	55821846	missense	probably damaging	1.00
R7650:Nfkbiz	UTSW	16	55817839	missense	probably benign	0.34
R7941:Nfkbiz	UTSW	16	55821944	missense	probably damaging	0.98
R8193:Nfkbiz	UTSW	16	55821851	missense	probably damaging	0.96
R8402:Nfkbiz	UTSW	16	55816387	missense	probably damaging	0.98
R9222:Nfkbiz	UTSW	16	55813984	missense	probably damaging	1.00
R9420:Nfkbiz	UTSW	16	55821974	missense	probably damaging	0.99
R9457:Nfkbiz	UTSW	16	55813984	missense	probably damaging	1.00
Z1088:Nfkbiz	UTSW	16	55816438	missense	probably damaging	1.00
Z1088:Nfkbiz	UTSW	16	55818236	missense	probably damaging	1.00

Predicted Primers

PCR Primer
(F):5'- CCAGCGTACTCAGACAGCTATC -3'
(R):5'- CTGCTTGAGGGCTTTATCCAC -3'

Sequencing Primer
(F):5'- CTAGGAACTCGGTCACCTATG -3'
(R):5'- TTGAGGGCTTTATCCACCAGGC -3'

Posted On

2016-07-06