Mutagenetix > Incidental Mutation

Incidental Mutation 'R5266:Asic4'

401684

Institutional Source

Beutler Lab

Gene Symbol

Asic4

Ensembl Gene

ENSMUSG00000033007

Gene Name

acid-sensing (proton-gated) ion channel family member 4

Synonyms

MMRRC Submission

042858-MU

Accession Numbers

Essential gene?

Non essential (E-score: 0.000) question?

Stock #

R5266 (G1)

Quality Score

195

Status

Not validated

Chromosome

Chromosomal Location

75450436-75474343 bp(+) (GRCm38)

Type of Mutation

missense

DNA Base Change (assembly)

G to A at 75450923 bp (GRCm38)

Zygosity

Heterozygous

Amino Acid Change

Glycine to Glutamic Acid at position 31 (G31E)

Ref Sequence

ENSEMBL: ENSMUSP00000045598 (fasta)

Gene Model

predicted gene model for transcript(s): [ENSMUST00000037708] [ENSMUST00000113577]

AlphaFold

Q7TNS7

Predicted Effect

probably benign
Transcript: ENSMUST00000037708
AA Change: G31E

PolyPhen 2 Score 0.029 (Sensitivity: 0.95; Specificity: 0.82)

SMART Domains

Protein: ENSMUSP00000045598
Gene: ENSMUSG00000033007
AA Change: G31E

Domain	Start	End	E-Value	Type
low complexity region	12	26	N/A	INTRINSIC
Pfam:ASC	45	464	5.3e-92	PFAM
low complexity region	507	533	N/A	INTRINSIC

Predicted Effect

probably benign
Transcript: ENSMUST00000113577
AA Change: G31E

PolyPhen 2 Score 0.011 (Sensitivity: 0.96; Specificity: 0.78)

SMART Domains

Protein: ENSMUSP00000109207
Gene: ENSMUSG00000033007
AA Change: G31E

Domain	Start	End	E-Value	Type
low complexity region	12	26	N/A	INTRINSIC
Pfam:ASC	45	346	5.5e-94	PFAM
Pfam:ASC	344	446	1.4e-42	PFAM
low complexity region	488	514	N/A	INTRINSIC

Coding Region Coverage

1x: 99.1%
3x: 98.3%
10x: 96.3%
20x: 92.6%

Validation Efficiency

97% (56/58)

MGI Phenotype

FUNCTION: [Summary is not available for the mouse gene. This summary is for the human ortholog.] This gene belongs to the superfamily of acid-sensing ion channels, which are proton-gated, amiloride-sensitive sodium channels. These channels have been implicated in synaptic transmission, pain perception as well as mechanoperception. This gene is predominantly expressed in the pituitary gland, and was considered a candidate for paroxysmal dystonic choreoathetosis (PDC), a movement disorder, however, no correlation was found between mutations in this gene and PDC. [provided by RefSeq, Feb 2012]
PHENOTYPE: Homozygous knockout increases the fear response in the predator-odor induced fear test and increases anxiety in open field and elevated plus maze tests. [provided by MGI curators]

Allele List at MGI

Other mutations in this stock

Total: 51 list
Gene	Ref	Var	Chr/Loc	Mutation	Predicted Effect	Zygosity
4930503L19Rik	T	C	18: 70,458,384	N457S	probably damaging	Het
Atp2a3	A	G	11: 72,975,397	D281G	probably damaging	Het
Azin1	T	C	15: 38,491,551	D387G	probably benign	Het
Bdp1	T	C	13: 100,067,535	M660V	probably benign	Het
Catsperg2	G	A	7: 29,717,066	T307M	probably damaging	Het
Cfap54	T	G	10: 92,815,902	K3095N	probably benign	Het
Chl1	A	G	6: 103,700,543	N706S	probably damaging	Het
Crym	A	G	7: 120,199,294	V113A	probably benign	Het
Cux1	A	G	5: 136,312,694	S607P	probably damaging	Het
Cyp3a44	T	C	5: 145,794,397	N198D	possibly damaging	Het
Dnase1l1	C	T	X: 74,277,038		probably null	Het
Elac1	A	G	18: 73,742,669	V97A	probably benign	Het
Erbb3	G	A	10: 128,569,636	T1251M	probably damaging	Het
Fam198b	T	A	3: 79,936,603	N12K	probably damaging	Het
Gprc5c	G	T	11: 114,864,267	V257L	possibly damaging	Het
Hydin	A	G	8: 110,334,784	H316R	possibly damaging	Het
Ikzf3	A	T	11: 98,490,580	M58K	probably benign	Het
Lyst	T	C	13: 13,660,970	Y1746H	probably damaging	Het
Map3k11	T	A	19: 5,700,594	N613K	probably benign	Het
Mfng	C	T	15: 78,764,388	R163H	probably benign	Het
Mrm1	A	T	11: 84,819,260	L38Q	possibly damaging	Het
Myo7b	A	G	18: 31,998,734	F470L	probably damaging	Het
Ndst2	G	A	14: 20,724,487	R834W	probably damaging	Het
Olfr1173	T	C	2: 88,274,221	Y276C	possibly damaging	Het
Olfr651	A	T	7: 104,553,819	Q300L	probably benign	Het
Opa1	T	A	16: 29,618,130	I637N	probably benign	Het
Padi4	A	G	4: 140,746,131	V665A	possibly damaging	Het
Pcdh1	A	G	18: 38,192,199	Y897H	probably damaging	Het
Pkp3	A	G	7: 141,083,277	D345G	probably damaging	Het
Pla2g4a	T	C	1: 149,865,167	M366V	possibly damaging	Het
Pnkp	C	T	7: 44,862,403	S113L	probably damaging	Het
Pon3	T	C	6: 5,240,860	D34G	possibly damaging	Het
Ppargc1b	A	T	18: 61,315,805	S133T	probably damaging	Het
Ppp4r3b	T	C	11: 29,173,309	S2P	possibly damaging	Het
Rbm20	A	G	19: 53,813,387	T109A	probably damaging	Het
Rexo5	C	A	7: 119,844,437	H690Q	probably benign	Het
Scube2	C	T	7: 109,809,230	G670D	probably damaging	Het
Sipa1l2	T	C	8: 125,492,126	I157M	probably damaging	Het
Slbp	A	T	5: 33,643,866	I167N	probably damaging	Het
Sry	C	G	Y: 2,662,975	Q228H	unknown	Het
Stk36	T	C	1: 74,611,158	V283A	probably benign	Het
Tead1	A	G	7: 112,759,466		probably benign	Het
Tecpr2	G	C	12: 110,915,402	W135S	probably damaging	Het
Tha1	A	C	11: 117,869,676	S241A	probably damaging	Het
Ttc39a	A	T	4: 109,422,504	I112F	probably benign	Het
Vmn1r128	A	T	7: 21,349,403	T11S	probably benign	Het
Vnn1	G	A	10: 23,903,405	C404Y	probably damaging	Het
Wdr41	T	C	13: 94,995,251	F57L	probably damaging	Het
Zfp975	T	G	7: 42,662,230	T320P	probably damaging	Het
Zfp985	A	T	4: 147,582,832		probably null	Het
Zfpm2	T	C	15: 41,099,469	S176P	probably benign	Het

Other mutations in Asic4

Allele	Source	Chr	Coord	Type	Predicted Effect	PPH Score
IGL01399:Asic4	APN	1	75469146	missense	possibly damaging	0.94
IGL01470:Asic4	APN	1	75450866	missense	probably damaging	1.00
IGL02645:Asic4	APN	1	75473354	unclassified	probably benign
IGL03002:Asic4	APN	1	75451323	missense	possibly damaging	0.61
positron	UTSW	1	75473043	nonsense	probably null
PIT4445001:Asic4	UTSW	1	75451127	missense	probably benign	0.03
R0106:Asic4	UTSW	1	75451127	missense	probably benign	0.03
R0138:Asic4	UTSW	1	75469687	missense	possibly damaging	0.87
R0453:Asic4	UTSW	1	75473511	unclassified	probably benign
R0573:Asic4	UTSW	1	75469102	splice site	probably benign
R0705:Asic4	UTSW	1	75451370	missense	probably damaging	1.00
R1892:Asic4	UTSW	1	75469482	missense	probably damaging	1.00
R1912:Asic4	UTSW	1	75469232	missense	possibly damaging	0.93
R3614:Asic4	UTSW	1	75473058	missense	probably damaging	1.00
R3790:Asic4	UTSW	1	75469841	unclassified	probably benign
R3923:Asic4	UTSW	1	75451227	missense	probably damaging	1.00
R4447:Asic4	UTSW	1	75470370	unclassified	probably benign
R5177:Asic4	UTSW	1	75450839	missense	probably damaging	1.00
R5208:Asic4	UTSW	1	75451226	missense	probably damaging	1.00
R5436:Asic4	UTSW	1	75451319	missense	probably benign	0.09
R5921:Asic4	UTSW	1	75451373	missense	probably benign	0.30
R6086:Asic4	UTSW	1	75473243	missense	possibly damaging	0.64
R6512:Asic4	UTSW	1	75473043	nonsense	probably null
R6530:Asic4	UTSW	1	75472335	missense	probably damaging	0.98
R7545:Asic4	UTSW	1	75472416	missense	probably damaging	0.98
R9129:Asic4	UTSW	1	75469825	missense	possibly damaging	0.77
R9322:Asic4	UTSW	1	75469818	missense	probably benign	0.38
Z1177:Asic4	UTSW	1	75469220	missense	probably benign	0.02

Predicted Primers

PCR Primer
(F):5'- GCCCTGAGTTTAGAAGAGCAG -3'
(R):5'- ATGTTGCAGAGGGTGACAGC -3'

Sequencing Primer
(F):5'- TGCCGCCACCACCACTC -3'
(R):5'- TCCATGGCTACCAGGTGAG -3'

Posted On

2016-07-06