Incidental Mutation 'R5266:Fam198b'
ID401687
Institutional Source Beutler Lab
Gene Symbol Fam198b
Ensembl Gene ENSMUSG00000027955
Gene Namefamily with sequence similarity 198, member B
Synonyms2210419I08Rik, 1110032E23Rik, Ened
MMRRC Submission 042858-MU
Accession Numbers

NCBI RefSeq: NM_133187.3; MGI:1915909

Is this an essential gene? Probably non essential (E-score: 0.056) question?
Stock #R5266 (G1)
Quality Score225
Status Validated
Chromosome3
Chromosomal Location79884533-79946280 bp(+) (GRCm38)
Type of Mutationmissense
DNA Base Change (assembly) T to A at 79936603 bp
ZygosityHeterozygous
Amino Acid Change Asparagine to Lysine at position 12 (N12K)
Ref Sequence ENSEMBL: ENSMUSP00000120603 (fasta)
Gene Model predicted gene model for transcript(s): [ENSMUST00000029567] [ENSMUST00000118853] [ENSMUST00000145992]
Predicted Effect possibly damaging
Transcript: ENSMUST00000029567
AA Change: N376K

PolyPhen 2 Score 0.933 (Sensitivity: 0.80; Specificity: 0.94)
SMART Domains Protein: ENSMUSP00000029567
Gene: ENSMUSG00000027955
AA Change: N376K

DomainStartEndE-ValueType
transmembrane domain 37 56 N/A INTRINSIC
Pfam:FAM198 202 516 9.1e-156 PFAM
Predicted Effect possibly damaging
Transcript: ENSMUST00000118853
AA Change: N376K

PolyPhen 2 Score 0.933 (Sensitivity: 0.80; Specificity: 0.94)
SMART Domains Protein: ENSMUSP00000114093
Gene: ENSMUSG00000027955
AA Change: N376K

DomainStartEndE-ValueType
transmembrane domain 37 56 N/A INTRINSIC
Pfam:FAM198 202 516 1.1e-155 PFAM
Predicted Effect probably damaging
Transcript: ENSMUST00000145992
AA Change: N12K

PolyPhen 2 Score 0.963 (Sensitivity: 0.78; Specificity: 0.95)
SMART Domains Protein: ENSMUSP00000120603
Gene: ENSMUSG00000027955
AA Change: N12K

DomainStartEndE-ValueType
Pfam:FAM198 1 51 5.4e-27 PFAM
Meta Mutation Damage Score 0.0958 question?
Coding Region Coverage
  • 1x: 99.1%
  • 3x: 98.3%
  • 10x: 96.3%
  • 20x: 92.6%
Validation Efficiency 97% (56/58)
Allele List at MGI

All alleles(2) : Targeted(2)

Other mutations in this stock
Total: 51 list
GeneRefVarChr/LocMutationPredicted EffectZygosity
4930503L19Rik T C 18: 70,458,384 N457S probably damaging Het
Asic4 G A 1: 75,450,923 G31E probably benign Het
Atp2a3 A G 11: 72,975,397 D281G probably damaging Het
Azin1 T C 15: 38,491,551 D387G probably benign Het
Bdp1 T C 13: 100,067,535 M660V probably benign Het
Catsperg2 G A 7: 29,717,066 T307M probably damaging Het
Cfap54 T G 10: 92,815,902 K3095N probably benign Het
Chl1 A G 6: 103,700,543 N706S probably damaging Het
Crym A G 7: 120,199,294 V113A probably benign Het
Cux1 A G 5: 136,312,694 S607P probably damaging Het
Cyp3a44 T C 5: 145,794,397 N198D possibly damaging Het
Dnase1l1 C T X: 74,277,038 probably null Het
Elac1 A G 18: 73,742,669 V97A probably benign Het
Erbb3 G A 10: 128,569,636 T1251M probably damaging Het
Gprc5c G T 11: 114,864,267 V257L possibly damaging Het
Hydin A G 8: 110,334,784 H316R possibly damaging Het
Ikzf3 A T 11: 98,490,580 M58K probably benign Het
Lyst T C 13: 13,660,970 Y1746H probably damaging Het
Map3k11 T A 19: 5,700,594 N613K probably benign Het
Mfng C T 15: 78,764,388 R163H probably benign Het
Mrm1 A T 11: 84,819,260 L38Q possibly damaging Het
Myo7b A G 18: 31,998,734 F470L probably damaging Het
Ndst2 G A 14: 20,724,487 R834W probably damaging Het
Olfr1173 T C 2: 88,274,221 Y276C possibly damaging Het
Olfr651 A T 7: 104,553,819 Q300L probably benign Het
Opa1 T A 16: 29,618,130 I637N probably benign Het
Padi4 A G 4: 140,746,131 V665A possibly damaging Het
Pcdh1 A G 18: 38,192,199 Y897H probably damaging Het
Pkp3 A G 7: 141,083,277 D345G probably damaging Het
Pla2g4a T C 1: 149,865,167 M366V possibly damaging Het
Pnkp C T 7: 44,862,403 S113L probably damaging Het
Pon3 T C 6: 5,240,860 D34G possibly damaging Het
Ppargc1b A T 18: 61,315,805 S133T probably damaging Het
Ppp4r3b T C 11: 29,173,309 S2P possibly damaging Het
Rbm20 A G 19: 53,813,387 T109A probably damaging Het
Rexo5 C A 7: 119,844,437 H690Q probably benign Het
Scube2 C T 7: 109,809,230 G670D probably damaging Het
Sipa1l2 T C 8: 125,492,126 I157M probably damaging Het
Slbp A T 5: 33,643,866 I167N probably damaging Het
Sry C G Y: 2,662,975 Q228H unknown Het
Stk36 T C 1: 74,611,158 V283A probably benign Het
Tead1 A G 7: 112,759,466 probably benign Het
Tecpr2 G C 12: 110,915,402 W135S probably damaging Het
Tha1 A C 11: 117,869,676 S241A probably damaging Het
Ttc39a A T 4: 109,422,504 I112F probably benign Het
Vmn1r128 A T 7: 21,349,403 T11S probably benign Het
Vnn1 G A 10: 23,903,405 C404Y probably damaging Het
Wdr41 T C 13: 94,995,251 F57L probably damaging Het
Zfp975 T G 7: 42,662,230 T320P probably damaging Het
Zfp985 A T 4: 147,582,832 probably null Het
Zfpm2 T C 15: 41,099,469 S176P probably benign Het
Other mutations in Fam198b
AlleleSourceChrCoordTypePredicted EffectPPH Score
IGL02952:Fam198b APN 3 79886339 missense probably damaging 1.00
P0015:Fam198b UTSW 3 79936608 missense probably damaging 1.00
PIT4362001:Fam198b UTSW 3 79886939 missense possibly damaging 0.78
R1519:Fam198b UTSW 3 79941464 missense possibly damaging 0.88
R1723:Fam198b UTSW 3 79936663 missense probably benign
R1782:Fam198b UTSW 3 79886531 missense possibly damaging 0.85
R3040:Fam198b UTSW 3 79887125 missense possibly damaging 0.95
R3840:Fam198b UTSW 3 79908590 missense probably benign 0.32
R4841:Fam198b UTSW 3 79936605 missense probably damaging 1.00
R4842:Fam198b UTSW 3 79936605 missense probably damaging 1.00
R4860:Fam198b UTSW 3 79936674 nonsense probably null
R4860:Fam198b UTSW 3 79936674 nonsense probably null
R5181:Fam198b UTSW 3 79886311 missense probably benign 0.08
R6353:Fam198b UTSW 3 79941340 missense probably damaging 1.00
R6698:Fam198b UTSW 3 79936595 missense probably damaging 0.97
R6856:Fam198b UTSW 3 79886141 intron probably benign
R6927:Fam198b UTSW 3 79941462 missense probably damaging 1.00
R7025:Fam198b UTSW 3 79886548 missense probably damaging 1.00
R7189:Fam198b UTSW 3 79886807 nonsense probably null
R7434:Fam198b UTSW 3 79941362 missense probably damaging 1.00
R7557:Fam198b UTSW 3 79886608 nonsense probably null
R7780:Fam198b UTSW 3 79941404 missense probably damaging 1.00
R7891:Fam198b UTSW 3 79886284 missense probably benign 0.00
R8812:Fam198b UTSW 3 79908771 missense possibly damaging 0.82
Predicted Primers PCR Primer
(F):5'- TCAGAGGGCTTTGAACTACG -3'
(R):5'- ACTCTCGGATGCCTTCTAACAAC -3'

Sequencing Primer
(F):5'- ACGGACTTATTCTAGCAGCTG -3'
(R):5'- CTCGGATGCCTTCTAACAACTTAAAG -3'
Posted On2016-07-06