Incidental Mutation 'R5266:Zfp985'
ID401690
Institutional Source Beutler Lab
Gene Symbol Zfp985
Ensembl Gene ENSMUSG00000065999
Gene Namezinc finger protein 985
SynonymsGm13154
MMRRC Submission 042858-MU
Accession Numbers
Is this an essential gene? Possibly non essential (E-score: 0.337) question?
Stock #R5266 (G1)
Quality Score149
Status Validated
Chromosome4
Chromosomal Location147553277-147585198 bp(+) (GRCm38)
Type of Mutationcritical splice acceptor site
DNA Base Change (assembly) A to T at 147582832 bp
ZygosityHeterozygous
Amino Acid Change
Ref Sequence ENSEMBL: ENSMUSP00000121177 (fasta)
Gene Model predicted gene model for transcript(s): [ENSMUST00000081742] [ENSMUST00000139784] [ENSMUST00000143885]
Predicted Effect probably null
Transcript: ENSMUST00000081742
SMART Domains Protein: ENSMUSP00000080438
Gene: ENSMUSG00000065999

DomainStartEndE-ValueType
KRAB 13 72 4.36e-15 SMART
ZnF_C2H2 238 260 8.34e-3 SMART
ZnF_C2H2 266 288 1.47e-3 SMART
ZnF_C2H2 294 316 2.36e-2 SMART
ZnF_C2H2 322 344 8.34e-3 SMART
ZnF_C2H2 350 372 7.67e-2 SMART
ZnF_C2H2 378 400 8.6e-5 SMART
ZnF_C2H2 406 428 8.6e-5 SMART
ZnF_C2H2 434 456 7.9e-4 SMART
ZnF_C2H2 462 484 1.95e-3 SMART
ZnF_C2H2 490 512 2.09e-3 SMART
Predicted Effect probably null
Transcript: ENSMUST00000139784
SMART Domains Protein: ENSMUSP00000123296
Gene: ENSMUSG00000065999

DomainStartEndE-ValueType
KRAB 13 72 4.36e-15 SMART
Predicted Effect probably null
Transcript: ENSMUST00000143885
SMART Domains Protein: ENSMUSP00000121177
Gene: ENSMUSG00000065999

DomainStartEndE-ValueType
KRAB 13 72 4.36e-15 SMART
Meta Mutation Damage Score 0.9755 question?
Coding Region Coverage
  • 1x: 99.1%
  • 3x: 98.3%
  • 10x: 96.3%
  • 20x: 92.6%
Validation Efficiency 97% (56/58)
Allele List at MGI
Other mutations in this stock
Total: 51 list
GeneRefVarChr/LocMutationPredicted EffectZygosity
4930503L19Rik T C 18: 70,458,384 N457S probably damaging Het
Asic4 G A 1: 75,450,923 G31E probably benign Het
Atp2a3 A G 11: 72,975,397 D281G probably damaging Het
Azin1 T C 15: 38,491,551 D387G probably benign Het
Bdp1 T C 13: 100,067,535 M660V probably benign Het
Catsperg2 G A 7: 29,717,066 T307M probably damaging Het
Cfap54 T G 10: 92,815,902 K3095N probably benign Het
Chl1 A G 6: 103,700,543 N706S probably damaging Het
Crym A G 7: 120,199,294 V113A probably benign Het
Cux1 A G 5: 136,312,694 S607P probably damaging Het
Cyp3a44 T C 5: 145,794,397 N198D possibly damaging Het
Dnase1l1 C T X: 74,277,038 probably null Het
Elac1 A G 18: 73,742,669 V97A probably benign Het
Erbb3 G A 10: 128,569,636 T1251M probably damaging Het
Fam198b T A 3: 79,936,603 N12K probably damaging Het
Gprc5c G T 11: 114,864,267 V257L possibly damaging Het
Hydin A G 8: 110,334,784 H316R possibly damaging Het
Ikzf3 A T 11: 98,490,580 M58K probably benign Het
Lyst T C 13: 13,660,970 Y1746H probably damaging Het
Map3k11 T A 19: 5,700,594 N613K probably benign Het
Mfng C T 15: 78,764,388 R163H probably benign Het
Mrm1 A T 11: 84,819,260 L38Q possibly damaging Het
Myo7b A G 18: 31,998,734 F470L probably damaging Het
Ndst2 G A 14: 20,724,487 R834W probably damaging Het
Olfr1173 T C 2: 88,274,221 Y276C possibly damaging Het
Olfr651 A T 7: 104,553,819 Q300L probably benign Het
Opa1 T A 16: 29,618,130 I637N probably benign Het
Padi4 A G 4: 140,746,131 V665A possibly damaging Het
Pcdh1 A G 18: 38,192,199 Y897H probably damaging Het
Pkp3 A G 7: 141,083,277 D345G probably damaging Het
Pla2g4a T C 1: 149,865,167 M366V possibly damaging Het
Pnkp C T 7: 44,862,403 S113L probably damaging Het
Pon3 T C 6: 5,240,860 D34G possibly damaging Het
Ppargc1b A T 18: 61,315,805 S133T probably damaging Het
Ppp4r3b T C 11: 29,173,309 S2P possibly damaging Het
Rbm20 A G 19: 53,813,387 T109A probably damaging Het
Rexo5 C A 7: 119,844,437 H690Q probably benign Het
Scube2 C T 7: 109,809,230 G670D probably damaging Het
Sipa1l2 T C 8: 125,492,126 I157M probably damaging Het
Slbp A T 5: 33,643,866 I167N probably damaging Het
Sry C G Y: 2,662,975 Q228H unknown Het
Stk36 T C 1: 74,611,158 V283A probably benign Het
Tead1 A G 7: 112,759,466 probably benign Het
Tecpr2 G C 12: 110,915,402 W135S probably damaging Het
Tha1 A C 11: 117,869,676 S241A probably damaging Het
Ttc39a A T 4: 109,422,504 I112F probably benign Het
Vmn1r128 A T 7: 21,349,403 T11S probably benign Het
Vnn1 G A 10: 23,903,405 C404Y probably damaging Het
Wdr41 T C 13: 94,995,251 F57L probably damaging Het
Zfp975 T G 7: 42,662,230 T320P probably damaging Het
Zfpm2 T C 15: 41,099,469 S176P probably benign Het
Other mutations in Zfp985
AlleleSourceChrCoordTypePredicted EffectPPH Score
R0098:Zfp985 UTSW 4 147577109 missense probably damaging 0.97
R0324:Zfp985 UTSW 4 147582857 missense probably benign 0.00
R1307:Zfp985 UTSW 4 147583247 missense probably benign
R1594:Zfp985 UTSW 4 147583080 missense probably benign 0.05
R1657:Zfp985 UTSW 4 147584110 missense probably benign 0.01
R1667:Zfp985 UTSW 4 147583950 missense possibly damaging 0.84
R1761:Zfp985 UTSW 4 147584045 missense probably benign 0.00
R1858:Zfp985 UTSW 4 147582858 missense probably benign 0.29
R2509:Zfp985 UTSW 4 147582986 missense possibly damaging 0.75
R2510:Zfp985 UTSW 4 147582986 missense possibly damaging 0.75
R2847:Zfp985 UTSW 4 147583011 nonsense probably null
R2848:Zfp985 UTSW 4 147583011 nonsense probably null
R4245:Zfp985 UTSW 4 147582939 missense probably damaging 0.96
R4260:Zfp985 UTSW 4 147583572 missense probably damaging 1.00
R4434:Zfp985 UTSW 4 147583911 missense probably benign 0.37
R4480:Zfp985 UTSW 4 147584079 missense probably benign 0.07
R4512:Zfp985 UTSW 4 147583563 missense probably damaging 1.00
R4514:Zfp985 UTSW 4 147583563 missense probably damaging 1.00
R4528:Zfp985 UTSW 4 147582890 missense possibly damaging 0.49
R4836:Zfp985 UTSW 4 147584155 missense probably damaging 0.97
R4884:Zfp985 UTSW 4 147583344 missense probably benign 0.04
R5054:Zfp985 UTSW 4 147582981 missense probably damaging 0.98
R5106:Zfp985 UTSW 4 147584155 missense probably damaging 0.97
R5205:Zfp985 UTSW 4 147582911 missense probably damaging 1.00
R5468:Zfp985 UTSW 4 147583245 missense probably benign
R5533:Zfp985 UTSW 4 147582983 nonsense probably null
R6282:Zfp985 UTSW 4 147583348 missense probably benign 0.00
R6303:Zfp985 UTSW 4 147583775 missense probably benign 0.01
R6609:Zfp985 UTSW 4 147583121 missense probably benign
R6609:Zfp985 UTSW 4 147583667 missense probably damaging 1.00
R6722:Zfp985 UTSW 4 147583071 missense probably benign 0.26
R6858:Zfp985 UTSW 4 147583307 nonsense probably null
R7064:Zfp985 UTSW 4 147583116 missense probably benign 0.20
R7216:Zfp985 UTSW 4 147583456 missense probably damaging 1.00
R7471:Zfp985 UTSW 4 147582931 missense possibly damaging 0.75
R7583:Zfp985 UTSW 4 147583489 nonsense probably null
R7685:Zfp985 UTSW 4 147582874 missense probably benign 0.00
R8242:Zfp985 UTSW 4 147584182 missense possibly damaging 0.52
R8504:Zfp985 UTSW 4 147583426 missense possibly damaging 0.70
X0050:Zfp985 UTSW 4 147583271 frame shift probably null
Predicted Primers PCR Primer
(F):5'- GCAGGCTATTATCATTTCCAGTC -3'
(R):5'- TTGGTTCCAGTATTGAAGAGAGC -3'

Sequencing Primer
(F):5'- CATATTTGAGGTTCTTCTGAGGATAC -3'
(R):5'- AGAGAGCTGTGATAAGTTTTGTAAG -3'
Posted On2016-07-06