Incidental Mutation 'R5266:Slbp'
ID401691
Institutional Source Beutler Lab
Gene Symbol Slbp
Ensembl Gene ENSMUSG00000004642
Gene Namestem-loop binding protein
Synonyms
MMRRC Submission 042858-MU
Accession Numbers
Is this an essential gene? Probably essential (E-score: 0.939) question?
Stock #R5266 (G1)
Quality Score225
Status Validated
Chromosome5
Chromosomal Location33634952-33652574 bp(-) (GRCm38)
Type of Mutationmissense
DNA Base Change (assembly) A to T at 33643866 bp
ZygosityHeterozygous
Amino Acid Change Isoleucine to Asparagine at position 167 (I167N)
Ref Sequence ENSEMBL: ENSMUSP00000075093 (fasta)
Gene Model predicted gene model for transcript(s): [ENSMUST00000057551] [ENSMUST00000075670] [ENSMUST00000101354] [ENSMUST00000139518] [ENSMUST00000151081]
Predicted Effect probably damaging
Transcript: ENSMUST00000057551
AA Change: I167N

PolyPhen 2 Score 0.985 (Sensitivity: 0.74; Specificity: 0.96)
SMART Domains Protein: ENSMUSP00000062930
Gene: ENSMUSG00000004642
AA Change: I167N

DomainStartEndE-ValueType
low complexity region 4 18 N/A INTRINSIC
low complexity region 30 41 N/A INTRINSIC
low complexity region 105 123 N/A INTRINSIC
Pfam:SLBP_RNA_bind 130 199 2e-32 PFAM
low complexity region 217 233 N/A INTRINSIC
Predicted Effect probably damaging
Transcript: ENSMUST00000075670
AA Change: I167N

PolyPhen 2 Score 0.990 (Sensitivity: 0.72; Specificity: 0.97)
SMART Domains Protein: ENSMUSP00000075093
Gene: ENSMUSG00000004642
AA Change: I167N

DomainStartEndE-ValueType
low complexity region 4 18 N/A INTRINSIC
low complexity region 30 41 N/A INTRINSIC
low complexity region 105 123 N/A INTRINSIC
Pfam:SLBP_RNA_bind 128 201 6.1e-39 PFAM
low complexity region 217 233 N/A INTRINSIC
Predicted Effect probably damaging
Transcript: ENSMUST00000101354
AA Change: I147N

PolyPhen 2 Score 0.985 (Sensitivity: 0.74; Specificity: 0.96)
SMART Domains Protein: ENSMUSP00000098906
Gene: ENSMUSG00000004642
AA Change: I147N

DomainStartEndE-ValueType
low complexity region 4 18 N/A INTRINSIC
low complexity region 30 41 N/A INTRINSIC
Pfam:SLBP_RNA_bind 108 180 8.1e-39 PFAM
low complexity region 197 213 N/A INTRINSIC
Predicted Effect probably damaging
Transcript: ENSMUST00000139518
AA Change: I167N

PolyPhen 2 Score 0.982 (Sensitivity: 0.75; Specificity: 0.96)
SMART Domains Protein: ENSMUSP00000144475
Gene: ENSMUSG00000004642
AA Change: I167N

DomainStartEndE-ValueType
low complexity region 4 18 N/A INTRINSIC
low complexity region 30 41 N/A INTRINSIC
low complexity region 105 123 N/A INTRINSIC
Pfam:SLBP_RNA_bind 130 199 3e-29 PFAM
Predicted Effect noncoding transcript
Transcript: ENSMUST00000143003
AA Change: I108N
Predicted Effect noncoding transcript
Transcript: ENSMUST00000143029
Predicted Effect noncoding transcript
Transcript: ENSMUST00000146889
Predicted Effect noncoding transcript
Transcript: ENSMUST00000148153
Predicted Effect probably benign
Transcript: ENSMUST00000151081
Meta Mutation Damage Score 0.4448 question?
Coding Region Coverage
  • 1x: 99.1%
  • 3x: 98.3%
  • 10x: 96.3%
  • 20x: 92.6%
Validation Efficiency 97% (56/58)
MGI Phenotype FUNCTION: [Summary is not available for the mouse gene. This summary is for the human ortholog.] This gene encodes a protein that binds to the stem-loop structure in replication-dependent histone mRNAs. Histone mRNAs do not contain introns or polyadenylation signals, and are processed by endonucleolytic cleavage. The stem-loop structure is essential for efficient processing but this structure also controls the transport, translation and stability of histone mRNAs. Expression of the protein is regulated during the cell cycle, increasing more than 10-fold during the latter part of G1. [provided by RefSeq, Jul 2008]
Allele List at MGI
Other mutations in this stock
Total: 51 list
GeneRefVarChr/LocMutationPredicted EffectZygosity
4930503L19Rik T C 18: 70,458,384 N457S probably damaging Het
Asic4 G A 1: 75,450,923 G31E probably benign Het
Atp2a3 A G 11: 72,975,397 D281G probably damaging Het
Azin1 T C 15: 38,491,551 D387G probably benign Het
Bdp1 T C 13: 100,067,535 M660V probably benign Het
Catsperg2 G A 7: 29,717,066 T307M probably damaging Het
Cfap54 T G 10: 92,815,902 K3095N probably benign Het
Chl1 A G 6: 103,700,543 N706S probably damaging Het
Crym A G 7: 120,199,294 V113A probably benign Het
Cux1 A G 5: 136,312,694 S607P probably damaging Het
Cyp3a44 T C 5: 145,794,397 N198D possibly damaging Het
Dnase1l1 C T X: 74,277,038 probably null Het
Elac1 A G 18: 73,742,669 V97A probably benign Het
Erbb3 G A 10: 128,569,636 T1251M probably damaging Het
Fam198b T A 3: 79,936,603 N12K probably damaging Het
Gprc5c G T 11: 114,864,267 V257L possibly damaging Het
Hydin A G 8: 110,334,784 H316R possibly damaging Het
Ikzf3 A T 11: 98,490,580 M58K probably benign Het
Lyst T C 13: 13,660,970 Y1746H probably damaging Het
Map3k11 T A 19: 5,700,594 N613K probably benign Het
Mfng C T 15: 78,764,388 R163H probably benign Het
Mrm1 A T 11: 84,819,260 L38Q possibly damaging Het
Myo7b A G 18: 31,998,734 F470L probably damaging Het
Ndst2 G A 14: 20,724,487 R834W probably damaging Het
Olfr1173 T C 2: 88,274,221 Y276C possibly damaging Het
Olfr651 A T 7: 104,553,819 Q300L probably benign Het
Opa1 T A 16: 29,618,130 I637N probably benign Het
Padi4 A G 4: 140,746,131 V665A possibly damaging Het
Pcdh1 A G 18: 38,192,199 Y897H probably damaging Het
Pkp3 A G 7: 141,083,277 D345G probably damaging Het
Pla2g4a T C 1: 149,865,167 M366V possibly damaging Het
Pnkp C T 7: 44,862,403 S113L probably damaging Het
Pon3 T C 6: 5,240,860 D34G possibly damaging Het
Ppargc1b A T 18: 61,315,805 S133T probably damaging Het
Ppp4r3b T C 11: 29,173,309 S2P possibly damaging Het
Rbm20 A G 19: 53,813,387 T109A probably damaging Het
Rexo5 C A 7: 119,844,437 H690Q probably benign Het
Scube2 C T 7: 109,809,230 G670D probably damaging Het
Sipa1l2 T C 8: 125,492,126 I157M probably damaging Het
Sry C G Y: 2,662,975 Q228H unknown Het
Stk36 T C 1: 74,611,158 V283A probably benign Het
Tead1 A G 7: 112,759,466 probably benign Het
Tecpr2 G C 12: 110,915,402 W135S probably damaging Het
Tha1 A C 11: 117,869,676 S241A probably damaging Het
Ttc39a A T 4: 109,422,504 I112F probably benign Het
Vmn1r128 A T 7: 21,349,403 T11S probably benign Het
Vnn1 G A 10: 23,903,405 C404Y probably damaging Het
Wdr41 T C 13: 94,995,251 F57L probably damaging Het
Zfp975 T G 7: 42,662,230 T320P probably damaging Het
Zfp985 A T 4: 147,582,832 probably null Het
Zfpm2 T C 15: 41,099,469 S176P probably benign Het
Other mutations in Slbp
AlleleSourceChrCoordTypePredicted EffectPPH Score
R0650:Slbp UTSW 5 33645489 unclassified probably benign
R0827:Slbp UTSW 5 33643822 missense probably damaging 1.00
R1717:Slbp UTSW 5 33645602 missense probably benign 0.04
R7616:Slbp UTSW 5 33643866 missense probably damaging 0.99
Predicted Primers PCR Primer
(F):5'- GCCTGTTCTCAGCAATGTTC -3'
(R):5'- AGGGTCTTGTTCATTTACCATTCTG -3'

Sequencing Primer
(F):5'- GTTCTCAGCAATGTTCAGGATAACC -3'
(R):5'- TGGAACTCACTCTGTAGACCAGG -3'
Posted On2016-07-06