Incidental Mutation 'R5266:Cux1'
ID401692
Institutional Source Beutler Lab
Gene Symbol Cux1
Ensembl Gene ENSMUSG00000029705
Gene Namecut-like homeobox 1
SynonymsCux-1, Cutl1, CDP, Cux
MMRRC Submission 042858-MU
Accession Numbers
Is this an essential gene? Probably essential (E-score: 0.923) question?
Stock #R5266 (G1)
Quality Score225
Status Validated
Chromosome5
Chromosomal Location136248135-136567490 bp(-) (GRCm38)
Type of Mutationmissense
DNA Base Change (assembly) A to G at 136312694 bp
ZygosityHeterozygous
Amino Acid Change Serine to Proline at position 607 (S607P)
Ref Sequence ENSEMBL: ENSMUSP00000135892 (fasta)
Gene Model predicted gene model for transcript(s): [ENSMUST00000004097] [ENSMUST00000175918] [ENSMUST00000175975] [ENSMUST00000175998] [ENSMUST00000176172] [ENSMUST00000176216] [ENSMUST00000176423] [ENSMUST00000176745] [ENSMUST00000176778] [ENSMUST00000177297]
Predicted Effect probably damaging
Transcript: ENSMUST00000004097
AA Change: S524P

PolyPhen 2 Score 0.999 (Sensitivity: 0.14; Specificity: 0.99)
SMART Domains Protein: ENSMUSP00000004097
Gene: ENSMUSG00000029705
AA Change: S524P

DomainStartEndE-ValueType
coiled coil region 16 45 N/A INTRINSIC
coiled coil region 110 365 N/A INTRINSIC
low complexity region 425 436 N/A INTRINSIC
CUT 452 538 5.06e-39 SMART
low complexity region 602 608 N/A INTRINSIC
low complexity region 620 642 N/A INTRINSIC
CUT 841 929 3.31e-43 SMART
low complexity region 956 972 N/A INTRINSIC
low complexity region 990 1011 N/A INTRINSIC
CUT 1024 1110 3.78e-38 SMART
HOX 1150 1212 6.32e-15 SMART
low complexity region 1224 1239 N/A INTRINSIC
low complexity region 1317 1379 N/A INTRINSIC
Predicted Effect noncoding transcript
Transcript: ENSMUST00000148082
Predicted Effect probably benign
Transcript: ENSMUST00000175918
SMART Domains Protein: ENSMUSP00000135606
Gene: ENSMUSG00000029705

DomainStartEndE-ValueType
coiled coil region 73 328 N/A INTRINSIC
Predicted Effect probably damaging
Transcript: ENSMUST00000175975
AA Change: S624P

PolyPhen 2 Score 0.999 (Sensitivity: 0.14; Specificity: 0.99)
SMART Domains Protein: ENSMUSP00000135223
Gene: ENSMUSG00000029705
AA Change: S624P

DomainStartEndE-ValueType
coiled coil region 1 169 N/A INTRINSIC
low complexity region 235 251 N/A INTRINSIC
low complexity region 277 289 N/A INTRINSIC
low complexity region 331 342 N/A INTRINSIC
CUT 358 444 5.06e-39 SMART
low complexity region 508 514 N/A INTRINSIC
low complexity region 526 548 N/A INTRINSIC
CUT 747 835 3.31e-43 SMART
low complexity region 862 878 N/A INTRINSIC
low complexity region 896 917 N/A INTRINSIC
CUT 930 1016 3.78e-38 SMART
HOX 1056 1118 6.32e-15 SMART
low complexity region 1130 1145 N/A INTRINSIC
low complexity region 1223 1285 N/A INTRINSIC
Predicted Effect probably benign
Transcript: ENSMUST00000175998
SMART Domains Protein: ENSMUSP00000135816
Gene: ENSMUSG00000029705

DomainStartEndE-ValueType
coiled coil region 1 39 N/A INTRINSIC
low complexity region 52 64 N/A INTRINSIC
coiled coil region 76 148 N/A INTRINSIC
Pfam:CASP_C 204 430 8.6e-72 PFAM
Predicted Effect probably damaging
Transcript: ENSMUST00000176172
AA Change: S615P

PolyPhen 2 Score 0.993 (Sensitivity: 0.70; Specificity: 0.97)
SMART Domains Protein: ENSMUSP00000135086
Gene: ENSMUSG00000029705
AA Change: S615P

DomainStartEndE-ValueType
coiled coil region 99 354 N/A INTRINSIC
low complexity region 420 436 N/A INTRINSIC
low complexity region 462 474 N/A INTRINSIC
low complexity region 516 527 N/A INTRINSIC
CUT 543 629 5.06e-39 SMART
low complexity region 693 699 N/A INTRINSIC
low complexity region 711 733 N/A INTRINSIC
CUT 932 1020 3.31e-43 SMART
low complexity region 1047 1063 N/A INTRINSIC
low complexity region 1081 1102 N/A INTRINSIC
CUT 1115 1201 3.78e-38 SMART
HOX 1241 1303 6.32e-15 SMART
low complexity region 1315 1330 N/A INTRINSIC
low complexity region 1408 1470 N/A INTRINSIC
Predicted Effect probably benign
Transcript: ENSMUST00000176216
SMART Domains Protein: ENSMUSP00000135054
Gene: ENSMUSG00000029705

DomainStartEndE-ValueType
coiled coil region 16 45 N/A INTRINSIC
coiled coil region 110 365 N/A INTRINSIC
internal_repeat_1 369 390 9.35e-5 PROSPERO
Pfam:CASP_C 421 647 1.2e-71 PFAM
Predicted Effect probably benign
Transcript: ENSMUST00000176423
SMART Domains Protein: ENSMUSP00000135036
Gene: ENSMUSG00000029705

DomainStartEndE-ValueType
coiled coil region 1 39 N/A INTRINSIC
low complexity region 52 64 N/A INTRINSIC
coiled coil region 76 148 N/A INTRINSIC
low complexity region 217 226 N/A INTRINSIC
Predicted Effect unknown
Transcript: ENSMUST00000176486
AA Change: S486P
SMART Domains Protein: ENSMUSP00000135370
Gene: ENSMUSG00000029705
AA Change: S486P

DomainStartEndE-ValueType
coiled coil region 16 45 N/A INTRINSIC
coiled coil region 110 363 N/A INTRINSIC
low complexity region 429 445 N/A INTRINSIC
low complexity region 471 483 N/A INTRINSIC
low complexity region 525 536 N/A INTRINSIC
CUT 552 638 5.06e-39 SMART
Blast:CUT 641 840 3e-50 BLAST
CUT 919 1007 3.31e-43 SMART
low complexity region 1034 1050 N/A INTRINSIC
low complexity region 1068 1089 N/A INTRINSIC
CUT 1102 1188 3.78e-38 SMART
HOX 1228 1290 6.32e-15 SMART
low complexity region 1302 1317 N/A INTRINSIC
low complexity region 1395 1457 N/A INTRINSIC
Predicted Effect probably benign
Transcript: ENSMUST00000176745
SMART Domains Protein: ENSMUSP00000135512
Gene: ENSMUSG00000029705

DomainStartEndE-ValueType
coiled coil region 16 45 N/A INTRINSIC
coiled coil region 110 363 N/A INTRINSIC
internal_repeat_1 367 388 8.95e-5 PROSPERO
Pfam:CASP_C 419 645 1.2e-71 PFAM
Predicted Effect probably damaging
Transcript: ENSMUST00000176778
AA Change: S607P

PolyPhen 2 Score 1.000 (Sensitivity: 0.00; Specificity: 1.00)
SMART Domains Protein: ENSMUSP00000135892
Gene: ENSMUSG00000029705
AA Change: S607P

DomainStartEndE-ValueType
low complexity region 78 86 N/A INTRINSIC
coiled coil region 195 448 N/A INTRINSIC
low complexity region 508 519 N/A INTRINSIC
CUT 535 621 5.06e-39 SMART
low complexity region 685 691 N/A INTRINSIC
low complexity region 703 725 N/A INTRINSIC
CUT 924 1012 3.31e-43 SMART
low complexity region 1039 1055 N/A INTRINSIC
low complexity region 1073 1094 N/A INTRINSIC
CUT 1107 1193 3.78e-38 SMART
HOX 1233 1295 6.32e-15 SMART
low complexity region 1307 1322 N/A INTRINSIC
low complexity region 1400 1462 N/A INTRINSIC
Predicted Effect probably benign
Transcript: ENSMUST00000177297
SMART Domains Protein: ENSMUSP00000134819
Gene: ENSMUSG00000029705

DomainStartEndE-ValueType
coiled coil region 16 45 N/A INTRINSIC
coiled coil region 110 365 N/A INTRINSIC
internal_repeat_1 369 390 8.99e-6 PROSPERO
Pfam:CASP_C 422 527 1.8e-17 PFAM
Meta Mutation Damage Score 0.8320 question?
Coding Region Coverage
  • 1x: 99.1%
  • 3x: 98.3%
  • 10x: 96.3%
  • 20x: 92.6%
Validation Efficiency 97% (56/58)
MGI Phenotype PHENOTYPE: Homozygotes for a targeted null mutation exhibit delayed lung development and neonatal mortality. Survivors show growth retardation and hair defects. Homozygotes for a partially deleted protein have curly hair, and females tend to lose their litters. [provided by MGI curators]
Allele List at MGI
Other mutations in this stock
Total: 51 list
GeneRefVarChr/LocMutationPredicted EffectZygosity
4930503L19Rik T C 18: 70,458,384 N457S probably damaging Het
Asic4 G A 1: 75,450,923 G31E probably benign Het
Atp2a3 A G 11: 72,975,397 D281G probably damaging Het
Azin1 T C 15: 38,491,551 D387G probably benign Het
Bdp1 T C 13: 100,067,535 M660V probably benign Het
Catsperg2 G A 7: 29,717,066 T307M probably damaging Het
Cfap54 T G 10: 92,815,902 K3095N probably benign Het
Chl1 A G 6: 103,700,543 N706S probably damaging Het
Crym A G 7: 120,199,294 V113A probably benign Het
Cyp3a44 T C 5: 145,794,397 N198D possibly damaging Het
Dnase1l1 C T X: 74,277,038 probably null Het
Elac1 A G 18: 73,742,669 V97A probably benign Het
Erbb3 G A 10: 128,569,636 T1251M probably damaging Het
Fam198b T A 3: 79,936,603 N12K probably damaging Het
Gprc5c G T 11: 114,864,267 V257L possibly damaging Het
Hydin A G 8: 110,334,784 H316R possibly damaging Het
Ikzf3 A T 11: 98,490,580 M58K probably benign Het
Lyst T C 13: 13,660,970 Y1746H probably damaging Het
Map3k11 T A 19: 5,700,594 N613K probably benign Het
Mfng C T 15: 78,764,388 R163H probably benign Het
Mrm1 A T 11: 84,819,260 L38Q possibly damaging Het
Myo7b A G 18: 31,998,734 F470L probably damaging Het
Ndst2 G A 14: 20,724,487 R834W probably damaging Het
Olfr1173 T C 2: 88,274,221 Y276C possibly damaging Het
Olfr651 A T 7: 104,553,819 Q300L probably benign Het
Opa1 T A 16: 29,618,130 I637N probably benign Het
Padi4 A G 4: 140,746,131 V665A possibly damaging Het
Pcdh1 A G 18: 38,192,199 Y897H probably damaging Het
Pkp3 A G 7: 141,083,277 D345G probably damaging Het
Pla2g4a T C 1: 149,865,167 M366V possibly damaging Het
Pnkp C T 7: 44,862,403 S113L probably damaging Het
Pon3 T C 6: 5,240,860 D34G possibly damaging Het
Ppargc1b A T 18: 61,315,805 S133T probably damaging Het
Ppp4r3b T C 11: 29,173,309 S2P possibly damaging Het
Rbm20 A G 19: 53,813,387 T109A probably damaging Het
Rexo5 C A 7: 119,844,437 H690Q probably benign Het
Scube2 C T 7: 109,809,230 G670D probably damaging Het
Sipa1l2 T C 8: 125,492,126 I157M probably damaging Het
Slbp A T 5: 33,643,866 I167N probably damaging Het
Sry C G Y: 2,662,975 Q228H unknown Het
Stk36 T C 1: 74,611,158 V283A probably benign Het
Tead1 A G 7: 112,759,466 probably benign Het
Tecpr2 G C 12: 110,915,402 W135S probably damaging Het
Tha1 A C 11: 117,869,676 S241A probably damaging Het
Ttc39a A T 4: 109,422,504 I112F probably benign Het
Vmn1r128 A T 7: 21,349,403 T11S probably benign Het
Vnn1 G A 10: 23,903,405 C404Y probably damaging Het
Wdr41 T C 13: 94,995,251 F57L probably damaging Het
Zfp975 T G 7: 42,662,230 T320P probably damaging Het
Zfp985 A T 4: 147,582,832 probably null Het
Zfpm2 T C 15: 41,099,469 S176P probably benign Het
Other mutations in Cux1
AlleleSourceChrCoordTypePredicted EffectPPH Score
IGL00846:Cux1 APN 5 136326796 missense probably damaging 1.00
IGL00966:Cux1 APN 5 136311491 intron probably benign
IGL01129:Cux1 APN 5 136304718 intron probably benign
IGL01885:Cux1 APN 5 136308447 missense possibly damaging 0.90
IGL01947:Cux1 APN 5 136275125 missense probably benign 0.04
IGL02259:Cux1 APN 5 136326833 missense probably damaging 1.00
IGL02666:Cux1 APN 5 136275315 nonsense probably null
IGL02826:Cux1 APN 5 136308003 missense probably damaging 1.00
IGL03014:Cux1 UTSW 5 136565525 intron probably benign
R0047:Cux1 UTSW 5 136363253 splice site probably benign
R0047:Cux1 UTSW 5 136363253 splice site probably benign
R0057:Cux1 UTSW 5 136256282 missense probably damaging 1.00
R0149:Cux1 UTSW 5 136279497 missense probably damaging 1.00
R0295:Cux1 UTSW 5 136313212 missense probably benign 0.04
R0361:Cux1 UTSW 5 136279497 missense probably damaging 1.00
R0533:Cux1 UTSW 5 136307859 missense probably damaging 1.00
R0630:Cux1 UTSW 5 136286835 missense probably damaging 1.00
R0801:Cux1 UTSW 5 136326929 missense probably damaging 0.97
R0884:Cux1 UTSW 5 136307835 missense probably damaging 1.00
R0976:Cux1 UTSW 5 136313290 missense probably damaging 1.00
R1073:Cux1 UTSW 5 136252541 critical splice donor site probably null
R1222:Cux1 UTSW 5 136275149 missense probably benign 0.18
R1518:Cux1 UTSW 5 136308279 missense probably benign 0.29
R1686:Cux1 UTSW 5 136275381 nonsense probably null
R1687:Cux1 UTSW 5 136312669 missense probably damaging 1.00
R1758:Cux1 UTSW 5 136392322 missense probably damaging 1.00
R1797:Cux1 UTSW 5 136275315 missense probably benign 0.22
R1919:Cux1 UTSW 5 136363319 nonsense probably null
R2051:Cux1 UTSW 5 136332658 missense probably damaging 1.00
R2339:Cux1 UTSW 5 136287008 missense probably damaging 1.00
R3438:Cux1 UTSW 5 136311560 missense probably damaging 0.97
R3713:Cux1 UTSW 5 136565543 intron probably benign
R3800:Cux1 UTSW 5 136316033 missense probably damaging 1.00
R3964:Cux1 UTSW 5 136282942 missense probably damaging 1.00
R4135:Cux1 UTSW 5 136307896 missense probably damaging 1.00
R4198:Cux1 UTSW 5 136286848 missense probably damaging 1.00
R4467:Cux1 UTSW 5 136312722 missense probably damaging 1.00
R4498:Cux1 UTSW 5 136312993 missense probably damaging 1.00
R4622:Cux1 UTSW 5 136308300 missense probably damaging 0.99
R4623:Cux1 UTSW 5 136308300 missense probably damaging 0.99
R4651:Cux1 UTSW 5 136567229 missense probably damaging 1.00
R4652:Cux1 UTSW 5 136567229 missense probably damaging 1.00
R4658:Cux1 UTSW 5 136250594 missense possibly damaging 0.80
R4665:Cux1 UTSW 5 136286799 missense probably damaging 1.00
R4704:Cux1 UTSW 5 136249201 missense probably benign 0.01
R4867:Cux1 UTSW 5 136274961 intron probably benign
R4965:Cux1 UTSW 5 136311556 missense possibly damaging 0.77
R5090:Cux1 UTSW 5 136313200 missense possibly damaging 0.95
R5155:Cux1 UTSW 5 136565441 intron probably benign
R5226:Cux1 UTSW 5 136370173 missense probably benign 0.01
R5252:Cux1 UTSW 5 136308297 missense probably damaging 0.98
R5399:Cux1 UTSW 5 136252604 missense possibly damaging 0.58
R5509:Cux1 UTSW 5 136275317 missense probably benign 0.13
R5609:Cux1 UTSW 5 136392320 missense probably damaging 1.00
R5681:Cux1 UTSW 5 136308184 missense probably damaging 1.00
R5993:Cux1 UTSW 5 136363271 missense probably benign 0.00
R6049:Cux1 UTSW 5 136332710 missense probably damaging 1.00
R6290:Cux1 UTSW 5 136311558 missense probably damaging 0.99
R6310:Cux1 UTSW 5 136275164 missense probably benign 0.10
R6351:Cux1 UTSW 5 136309792 missense probably damaging 1.00
R6531:Cux1 UTSW 5 136275119 missense probably benign 0.03
R6590:Cux1 UTSW 5 136340117 missense probably damaging 0.99
R6663:Cux1 UTSW 5 136485847 missense probably damaging 1.00
R6690:Cux1 UTSW 5 136340117 missense probably damaging 0.99
R6777:Cux1 UTSW 5 136565568 intron probably benign
R6786:Cux1 UTSW 5 136567231 missense probably damaging 1.00
R6817:Cux1 UTSW 5 136373173 intron probably null
R6989:Cux1 UTSW 5 136279648 nonsense probably null
R7011:Cux1 UTSW 5 136360033 missense probably damaging 1.00
R7167:Cux1 UTSW 5 136310041 intron probably null
Predicted Primers PCR Primer
(F):5'- CACTTTCCAAGGTCAGAGTTCC -3'
(R):5'- CAGGTCAAAGAGCAGCTCATC -3'

Sequencing Primer
(F):5'- CAAAGCTAATGGTTTCTAGCTCCG -3'
(R):5'- TCAAGCACAACATTGGCCAG -3'
Posted On2016-07-06