Incidental Mutation 'R5266:Pon3'
ID401694
Institutional Source Beutler Lab
Gene Symbol Pon3
Ensembl Gene ENSMUSG00000029759
Gene Nameparaoxonase 3
Synonyms
MMRRC Submission 042858-MU
Accession Numbers
Is this an essential gene? Essential (E-score: 1.000) question?
Stock #R5266 (G1)
Quality Score225
Status Validated
Chromosome6
Chromosomal Location5220852-5256286 bp(-) (GRCm38)
Type of Mutationmissense
DNA Base Change (assembly) T to C at 5240860 bp
ZygosityHeterozygous
Amino Acid Change Aspartic acid to Glycine at position 34 (D34G)
Ref Sequence ENSEMBL: ENSMUSP00000135603 (fasta)
Gene Model predicted gene model for transcript(s): [ENSMUST00000031773] [ENSMUST00000125686] [ENSMUST00000129344]
Predicted Effect possibly damaging
Transcript: ENSMUST00000031773
AA Change: D107G

PolyPhen 2 Score 0.651 (Sensitivity: 0.87; Specificity: 0.91)
SMART Domains Protein: ENSMUSP00000031773
Gene: ENSMUSG00000029759
AA Change: D107G

DomainStartEndE-ValueType
Pfam:SGL 84 304 8.8e-9 PFAM
Pfam:Arylesterase 167 252 2.5e-43 PFAM
Pfam:Str_synth 184 250 3e-8 PFAM
Predicted Effect possibly damaging
Transcript: ENSMUST00000125686
AA Change: D34G

PolyPhen 2 Score 0.661 (Sensitivity: 0.86; Specificity: 0.91)
SMART Domains Protein: ENSMUSP00000135603
Gene: ENSMUSG00000029759
AA Change: D34G

DomainStartEndE-ValueType
Pfam:Arylesterase 94 135 9.1e-20 PFAM
Predicted Effect probably benign
Transcript: ENSMUST00000129344
SMART Domains Protein: ENSMUSP00000118137
Gene: ENSMUSG00000029759

DomainStartEndE-ValueType
PDB:4HHQ|A 1 67 3e-17 PDB
Predicted Effect noncoding transcript
Transcript: ENSMUST00000156848
Predicted Effect noncoding transcript
Transcript: ENSMUST00000176948
SMART Domains Protein: ENSMUSP00000135554
Gene: ENSMUSG00000029759

DomainStartEndE-ValueType
PDB:3SRG|A 3 90 1e-33 PDB
Meta Mutation Damage Score 0.2769 question?
Coding Region Coverage
  • 1x: 99.1%
  • 3x: 98.3%
  • 10x: 96.3%
  • 20x: 92.6%
Validation Efficiency 97% (56/58)
MGI Phenotype FUNCTION: [Summary is not available for the mouse gene. This summary is for the human ortholog.] This gene is a member of the paraoxonase family and lies in a cluster on chromosome 7 with the other two family members. The encoded protein is secreted into the bloodstream and associates with high-density lipoprotein (HDL). The protein also rapidly hydrolyzes lactones and can inhibit the oxidation of low-density lipoprotein (LDL), a function that is believed to slow the initiation and progression of atherosclerosis. Alternatively spliced variants which encode different protein isoforms have been described; however, only one has been fully characterized. [provided by RefSeq, Jul 2008]
PHENOTYPE: Homozygotes for a null allele show prenatal and postnatal lethality. Homozygotes for a different null allele are viable but show altered lipid and bile acid metabolism, impaired mitochondrial respiration, and increased susceptibility to diet-induced atherosclerosis, gallstone formation, and obesity. [provided by MGI curators]
Allele List at MGI
Other mutations in this stock
Total: 51 list
GeneRefVarChr/LocMutationPredicted EffectZygosity
4930503L19Rik T C 18: 70,458,384 N457S probably damaging Het
Asic4 G A 1: 75,450,923 G31E probably benign Het
Atp2a3 A G 11: 72,975,397 D281G probably damaging Het
Azin1 T C 15: 38,491,551 D387G probably benign Het
Bdp1 T C 13: 100,067,535 M660V probably benign Het
Catsperg2 G A 7: 29,717,066 T307M probably damaging Het
Cfap54 T G 10: 92,815,902 K3095N probably benign Het
Chl1 A G 6: 103,700,543 N706S probably damaging Het
Crym A G 7: 120,199,294 V113A probably benign Het
Cux1 A G 5: 136,312,694 S607P probably damaging Het
Cyp3a44 T C 5: 145,794,397 N198D possibly damaging Het
Dnase1l1 C T X: 74,277,038 probably null Het
Elac1 A G 18: 73,742,669 V97A probably benign Het
Erbb3 G A 10: 128,569,636 T1251M probably damaging Het
Fam198b T A 3: 79,936,603 N12K probably damaging Het
Gprc5c G T 11: 114,864,267 V257L possibly damaging Het
Hydin A G 8: 110,334,784 H316R possibly damaging Het
Ikzf3 A T 11: 98,490,580 M58K probably benign Het
Lyst T C 13: 13,660,970 Y1746H probably damaging Het
Map3k11 T A 19: 5,700,594 N613K probably benign Het
Mfng C T 15: 78,764,388 R163H probably benign Het
Mrm1 A T 11: 84,819,260 L38Q possibly damaging Het
Myo7b A G 18: 31,998,734 F470L probably damaging Het
Ndst2 G A 14: 20,724,487 R834W probably damaging Het
Olfr1173 T C 2: 88,274,221 Y276C possibly damaging Het
Olfr651 A T 7: 104,553,819 Q300L probably benign Het
Opa1 T A 16: 29,618,130 I637N probably benign Het
Padi4 A G 4: 140,746,131 V665A possibly damaging Het
Pcdh1 A G 18: 38,192,199 Y897H probably damaging Het
Pkp3 A G 7: 141,083,277 D345G probably damaging Het
Pla2g4a T C 1: 149,865,167 M366V possibly damaging Het
Pnkp C T 7: 44,862,403 S113L probably damaging Het
Ppargc1b A T 18: 61,315,805 S133T probably damaging Het
Ppp4r3b T C 11: 29,173,309 S2P possibly damaging Het
Rbm20 A G 19: 53,813,387 T109A probably damaging Het
Rexo5 C A 7: 119,844,437 H690Q probably benign Het
Scube2 C T 7: 109,809,230 G670D probably damaging Het
Sipa1l2 T C 8: 125,492,126 I157M probably damaging Het
Slbp A T 5: 33,643,866 I167N probably damaging Het
Sry C G Y: 2,662,975 Q228H unknown Het
Stk36 T C 1: 74,611,158 V283A probably benign Het
Tead1 A G 7: 112,759,466 probably benign Het
Tecpr2 G C 12: 110,915,402 W135S probably damaging Het
Tha1 A C 11: 117,869,676 S241A probably damaging Het
Ttc39a A T 4: 109,422,504 I112F probably benign Het
Vmn1r128 A T 7: 21,349,403 T11S probably benign Het
Vnn1 G A 10: 23,903,405 C404Y probably damaging Het
Wdr41 T C 13: 94,995,251 F57L probably damaging Het
Zfp975 T G 7: 42,662,230 T320P probably damaging Het
Zfp985 A T 4: 147,582,832 probably null Het
Zfpm2 T C 15: 41,099,469 S176P probably benign Het
Other mutations in Pon3
AlleleSourceChrCoordTypePredicted EffectPPH Score
IGL01977:Pon3 APN 6 5221670 missense probably damaging 1.00
IGL01983:Pon3 APN 6 5240974 missense probably damaging 1.00
IGL02601:Pon3 APN 6 5221671 missense probably damaging 1.00
IGL02661:Pon3 APN 6 5256205 missense probably benign 0.05
IGL03168:Pon3 APN 6 5256177 missense possibly damaging 0.54
IGL02988:Pon3 UTSW 6 5232330 missense possibly damaging 0.91
R0242:Pon3 UTSW 6 5240860 missense probably benign 0.25
R0242:Pon3 UTSW 6 5240860 missense probably benign 0.25
R0566:Pon3 UTSW 6 5232408 missense possibly damaging 0.89
R0730:Pon3 UTSW 6 5230444 missense probably benign 0.18
R1378:Pon3 UTSW 6 5230813 missense probably benign 0.08
R1955:Pon3 UTSW 6 5230774 missense probably benign 0.02
R2697:Pon3 UTSW 6 5232429 missense possibly damaging 0.67
R2975:Pon3 UTSW 6 5232345 missense probably damaging 1.00
R3794:Pon3 UTSW 6 5221578 missense probably benign 0.22
R4940:Pon3 UTSW 6 5221625 missense possibly damaging 0.75
R4988:Pon3 UTSW 6 5254582 nonsense probably null
R4990:Pon3 UTSW 6 5221619 missense probably benign
R5473:Pon3 UTSW 6 5256177 missense possibly damaging 0.54
R6152:Pon3 UTSW 6 5221716 missense probably damaging 1.00
R6746:Pon3 UTSW 6 5230786 missense possibly damaging 0.54
R7140:Pon3 UTSW 6 5221664 missense possibly damaging 0.92
R7450:Pon3 UTSW 6 5236940 missense possibly damaging 0.80
R7853:Pon3 UTSW 6 5236911 missense probably damaging 1.00
R8481:Pon3 UTSW 6 5221715 missense probably benign 0.23
Predicted Primers PCR Primer
(F):5'- TCAGGTCAGCCATCCTTCAC -3'
(R):5'- TGAAATGCAGAACCTGGGAC -3'

Sequencing Primer
(F):5'- CCCTGTGAACATTAAAACTTTTGC -3'
(R):5'- ATGCAGAACCTGGGACATTTTTG -3'
Posted On2016-07-06