Incidental Mutation 'R5266:Pnkp'
ID401700
Institutional Source Beutler Lab
Gene Symbol Pnkp
Ensembl Gene ENSMUSG00000002963
Gene Namepolynucleotide kinase 3'- phosphatase
SynonymsPNK, 1810009G08Rik
MMRRC Submission 042858-MU
Accession Numbers
Is this an essential gene? Probably essential (E-score: 0.960) question?
Stock #R5266 (G1)
Quality Score222
Status Validated
Chromosome7
Chromosomal Location44857139-44862992 bp(+) (GRCm38)
Type of Mutationmissense
DNA Base Change (assembly) C to T at 44862403 bp
ZygosityHeterozygous
Amino Acid Change Serine to Leucine at position 113 (S113L)
Ref Sequence ENSEMBL: ENSMUSP00000144484 (fasta)
Gene Model predicted gene model for transcript(s): [ENSMUST00000003044] [ENSMUST00000046575] [ENSMUST00000098478] [ENSMUST00000107876] [ENSMUST00000123015] [ENSMUST00000124168] [ENSMUST00000139003] [ENSMUST00000154968] [ENSMUST00000155050] [ENSMUST00000200892] [ENSMUST00000201882] [ENSMUST00000202646] [ENSMUST00000207363] [ENSMUST00000209018]
Predicted Effect probably damaging
Transcript: ENSMUST00000003044
AA Change: S474L

PolyPhen 2 Score 0.970 (Sensitivity: 0.77; Specificity: 0.96)
SMART Domains Protein: ENSMUSP00000003044
Gene: ENSMUSG00000002963
AA Change: S474L

DomainStartEndE-ValueType
PDB:1YJM|C 1 110 4e-62 PDB
SCOP:d1lgpa_ 8 114 5e-12 SMART
Blast:FHA 31 74 1e-10 BLAST
low complexity region 116 134 N/A INTRINSIC
Pfam:PNK3P 165 327 9.3e-58 PFAM
low complexity region 350 364 N/A INTRINSIC
Pfam:AAA_33 366 488 1.6e-17 PFAM
Predicted Effect probably benign
Transcript: ENSMUST00000046575
SMART Domains Protein: ENSMUSP00000035281
Gene: ENSMUSG00000038502

DomainStartEndE-ValueType
low complexity region 10 50 N/A INTRINSIC
low complexity region 64 82 N/A INTRINSIC
Pfam:Med25 89 238 1.7e-58 PFAM
Pfam:Med25 254 399 4.2e-57 PFAM
Predicted Effect possibly damaging
Transcript: ENSMUST00000098478
AA Change: S438L

PolyPhen 2 Score 0.692 (Sensitivity: 0.86; Specificity: 0.92)
SMART Domains Protein: ENSMUSP00000096078
Gene: ENSMUSG00000002963
AA Change: S438L

DomainStartEndE-ValueType
PDB:1YJM|C 1 110 2e-62 PDB
SCOP:d1lgpa_ 8 114 5e-12 SMART
Blast:FHA 31 74 1e-10 BLAST
low complexity region 116 134 N/A INTRINSIC
Pfam:PNK3P 165 220 2.9e-16 PFAM
Pfam:PNK3P 211 291 5.3e-27 PFAM
low complexity region 314 328 N/A INTRINSIC
Pfam:AAA_33 330 452 5.6e-26 PFAM
Predicted Effect probably damaging
Transcript: ENSMUST00000107876
AA Change: S474L

PolyPhen 2 Score 0.970 (Sensitivity: 0.77; Specificity: 0.96)
SMART Domains Protein: ENSMUSP00000103508
Gene: ENSMUSG00000002963
AA Change: S474L

DomainStartEndE-ValueType
PDB:1YJM|C 1 110 4e-62 PDB
SCOP:d1lgpa_ 8 114 5e-12 SMART
Blast:FHA 31 74 1e-10 BLAST
low complexity region 116 134 N/A INTRINSIC
Pfam:PNK3P 165 327 1.9e-57 PFAM
low complexity region 350 364 N/A INTRINSIC
Pfam:AAA_33 366 488 5.9e-26 PFAM
Predicted Effect probably benign
Transcript: ENSMUST00000123015
SMART Domains Protein: ENSMUSP00000143862
Gene: ENSMUSG00000002963

DomainStartEndE-ValueType
PDB:1YJ5|C 1 143 8e-72 PDB
SCOP:d1lgpa_ 8 114 7e-13 SMART
Blast:FHA 31 74 2e-10 BLAST
PDB:3U7G|A 144 165 7e-6 PDB
Predicted Effect probably benign
Transcript: ENSMUST00000124168
SMART Domains Protein: ENSMUSP00000144330
Gene: ENSMUSG00000002963

DomainStartEndE-ValueType
PDB:1YJM|C 1 51 3e-30 PDB
Predicted Effect noncoding transcript
Transcript: ENSMUST00000126860
Predicted Effect probably benign
Transcript: ENSMUST00000139003
SMART Domains Protein: ENSMUSP00000143904
Gene: ENSMUSG00000002963

DomainStartEndE-ValueType
PDB:1YJM|C 1 51 3e-30 PDB
Predicted Effect noncoding transcript
Transcript: ENSMUST00000144669
Predicted Effect noncoding transcript
Transcript: ENSMUST00000145850
Predicted Effect noncoding transcript
Transcript: ENSMUST00000152747
Predicted Effect probably benign
Transcript: ENSMUST00000154968
Predicted Effect probably benign
Transcript: ENSMUST00000155050
SMART Domains Protein: ENSMUSP00000144663
Gene: ENSMUSG00000002963

DomainStartEndE-ValueType
PDB:1YJM|C 1 50 9e-30 PDB
Predicted Effect probably damaging
Transcript: ENSMUST00000200892
AA Change: S95L

PolyPhen 2 Score 0.991 (Sensitivity: 0.71; Specificity: 0.97)
SMART Domains Protein: ENSMUSP00000144163
Gene: ENSMUSG00000002963
AA Change: S95L

DomainStartEndE-ValueType
Pfam:AAA_33 18 100 3.9e-9 PFAM
Predicted Effect probably benign
Transcript: ENSMUST00000201882
SMART Domains Protein: ENSMUSP00000144690
Gene: ENSMUSG00000002963

DomainStartEndE-ValueType
PDB:1YJM|C 1 110 6e-63 PDB
SCOP:d1lgpa_ 8 114 3e-12 SMART
Blast:FHA 31 74 2e-10 BLAST
low complexity region 116 134 N/A INTRINSIC
Pfam:PNK3P 165 327 9.9e-55 PFAM
low complexity region 350 364 N/A INTRINSIC
Predicted Effect probably damaging
Transcript: ENSMUST00000202646
AA Change: S113L

PolyPhen 2 Score 0.992 (Sensitivity: 0.70; Specificity: 0.97)
SMART Domains Protein: ENSMUSP00000144484
Gene: ENSMUSG00000002963
AA Change: S113L

DomainStartEndE-ValueType
Pfam:AAA_33 5 44 6.1e-7 PFAM
Pfam:AAA_33 37 117 4.2e-9 PFAM
Predicted Effect noncoding transcript
Transcript: ENSMUST00000207303
Predicted Effect probably benign
Transcript: ENSMUST00000207363
Predicted Effect noncoding transcript
Transcript: ENSMUST00000207393
Predicted Effect probably benign
Transcript: ENSMUST00000207416
Predicted Effect probably benign
Transcript: ENSMUST00000208385
Predicted Effect probably benign
Transcript: ENSMUST00000208410
Predicted Effect noncoding transcript
Transcript: ENSMUST00000208655
Predicted Effect probably benign
Transcript: ENSMUST00000208666
Predicted Effect probably benign
Transcript: ENSMUST00000208682
Predicted Effect noncoding transcript
Transcript: ENSMUST00000208687
Predicted Effect noncoding transcript
Transcript: ENSMUST00000208765
Predicted Effect noncoding transcript
Transcript: ENSMUST00000208991
Predicted Effect noncoding transcript
Transcript: ENSMUST00000209003
Predicted Effect probably benign
Transcript: ENSMUST00000209018
Predicted Effect noncoding transcript
Transcript: ENSMUST00000209139
Meta Mutation Damage Score 0.2697 question?
Coding Region Coverage
  • 1x: 99.1%
  • 3x: 98.3%
  • 10x: 96.3%
  • 20x: 92.6%
Validation Efficiency 97% (56/58)
MGI Phenotype FUNCTION: [Summary is not available for the mouse gene. This summary is for the human ortholog.] This locus represents a gene involved in DNA repair. In response to ionizing radiation or oxidative damage, the protein encoded by this locus catalyzes 5' phosphorylation and 3' dephosphorylation of nucleic acids. Mutations at this locus have been associated with microcephaly, seizures, and developmental delay.[provided by RefSeq, Sep 2010]
PHENOTYPE: Homozygotes for a frame-shift allele are embryonic lethal. Homozygotes for a hypomorphic allele exhibit smaller brain (cortex and cerebellum) and defects in both single- and double-strand DNA break repair associated with increased brain apoptosis and decreased proliferation in cortical progenitors. [provided by MGI curators]
Allele List at MGI
Other mutations in this stock
Total: 51 list
GeneRefVarChr/LocMutationPredicted EffectZygosity
4930503L19Rik T C 18: 70,458,384 N457S probably damaging Het
Asic4 G A 1: 75,450,923 G31E probably benign Het
Atp2a3 A G 11: 72,975,397 D281G probably damaging Het
Azin1 T C 15: 38,491,551 D387G probably benign Het
Bdp1 T C 13: 100,067,535 M660V probably benign Het
Catsperg2 G A 7: 29,717,066 T307M probably damaging Het
Cfap54 T G 10: 92,815,902 K3095N probably benign Het
Chl1 A G 6: 103,700,543 N706S probably damaging Het
Crym A G 7: 120,199,294 V113A probably benign Het
Cux1 A G 5: 136,312,694 S607P probably damaging Het
Cyp3a44 T C 5: 145,794,397 N198D possibly damaging Het
Dnase1l1 C T X: 74,277,038 probably null Het
Elac1 A G 18: 73,742,669 V97A probably benign Het
Erbb3 G A 10: 128,569,636 T1251M probably damaging Het
Fam198b T A 3: 79,936,603 N12K probably damaging Het
Gprc5c G T 11: 114,864,267 V257L possibly damaging Het
Hydin A G 8: 110,334,784 H316R possibly damaging Het
Ikzf3 A T 11: 98,490,580 M58K probably benign Het
Lyst T C 13: 13,660,970 Y1746H probably damaging Het
Map3k11 T A 19: 5,700,594 N613K probably benign Het
Mfng C T 15: 78,764,388 R163H probably benign Het
Mrm1 A T 11: 84,819,260 L38Q possibly damaging Het
Myo7b A G 18: 31,998,734 F470L probably damaging Het
Ndst2 G A 14: 20,724,487 R834W probably damaging Het
Olfr1173 T C 2: 88,274,221 Y276C possibly damaging Het
Olfr651 A T 7: 104,553,819 Q300L probably benign Het
Opa1 T A 16: 29,618,130 I637N probably benign Het
Padi4 A G 4: 140,746,131 V665A possibly damaging Het
Pcdh1 A G 18: 38,192,199 Y897H probably damaging Het
Pkp3 A G 7: 141,083,277 D345G probably damaging Het
Pla2g4a T C 1: 149,865,167 M366V possibly damaging Het
Pon3 T C 6: 5,240,860 D34G possibly damaging Het
Ppargc1b A T 18: 61,315,805 S133T probably damaging Het
Ppp4r3b T C 11: 29,173,309 S2P possibly damaging Het
Rbm20 A G 19: 53,813,387 T109A probably damaging Het
Rexo5 C A 7: 119,844,437 H690Q probably benign Het
Scube2 C T 7: 109,809,230 G670D probably damaging Het
Sipa1l2 T C 8: 125,492,126 I157M probably damaging Het
Slbp A T 5: 33,643,866 I167N probably damaging Het
Sry C G Y: 2,662,975 Q228H unknown Het
Stk36 T C 1: 74,611,158 V283A probably benign Het
Tead1 A G 7: 112,759,466 probably benign Het
Tecpr2 G C 12: 110,915,402 W135S probably damaging Het
Tha1 A C 11: 117,869,676 S241A probably damaging Het
Ttc39a A T 4: 109,422,504 I112F probably benign Het
Vmn1r128 A T 7: 21,349,403 T11S probably benign Het
Vnn1 G A 10: 23,903,405 C404Y probably damaging Het
Wdr41 T C 13: 94,995,251 F57L probably damaging Het
Zfp975 T G 7: 42,662,230 T320P probably damaging Het
Zfp985 A T 4: 147,582,832 probably null Het
Zfpm2 T C 15: 41,099,469 S176P probably benign Het
Other mutations in Pnkp
AlleleSourceChrCoordTypePredicted EffectPPH Score
IGL01886:Pnkp APN 7 44862207 missense probably damaging 1.00
IGL02750:Pnkp APN 7 44860187 unclassified probably benign
IGL02822:Pnkp APN 7 44862424 missense probably damaging 1.00
R1168:Pnkp UTSW 7 44862537 missense probably benign 0.00
R1437:Pnkp UTSW 7 44860402 missense possibly damaging 0.87
R1953:Pnkp UTSW 7 44862602 missense probably benign 0.02
R2879:Pnkp UTSW 7 44858678 missense probably damaging 0.99
R4329:Pnkp UTSW 7 44858594 missense probably benign 0.02
R4732:Pnkp UTSW 7 44860454 unclassified probably benign
R4842:Pnkp UTSW 7 44861646 splice site probably null
R4846:Pnkp UTSW 7 44862403 missense probably damaging 0.99
R4861:Pnkp UTSW 7 44862403 missense probably damaging 0.99
R4861:Pnkp UTSW 7 44862403 missense probably damaging 0.99
R4872:Pnkp UTSW 7 44862403 missense probably damaging 0.99
R4873:Pnkp UTSW 7 44862403 missense probably damaging 0.99
R4875:Pnkp UTSW 7 44862403 missense probably damaging 0.99
R5068:Pnkp UTSW 7 44862403 missense probably damaging 0.99
R5120:Pnkp UTSW 7 44862403 missense probably damaging 0.99
R5121:Pnkp UTSW 7 44862403 missense probably damaging 0.99
R5267:Pnkp UTSW 7 44862403 missense probably damaging 0.99
R6532:Pnkp UTSW 7 44857405 start codon destroyed probably null 0.99
R6974:Pnkp UTSW 7 44861038 missense probably damaging 1.00
R7289:Pnkp UTSW 7 44858690 missense probably damaging 1.00
R7326:Pnkp UTSW 7 44859734 missense probably damaging 1.00
R7394:Pnkp UTSW 7 44858678 missense probably damaging 0.99
R7573:Pnkp UTSW 7 44857428 missense probably damaging 1.00
Predicted Primers PCR Primer
(F):5'- AGCTGTTTTGCCTCCACAGG -3'
(R):5'- AGATGCTCCTGTAACCGGAATG -3'

Sequencing Primer
(F):5'- GTACATCCAATGTGCCAAAGATG -3'
(R):5'- TGCTCCTGTAACCGGAATGGAATC -3'
Posted On2016-07-06