Incidental Mutation 'R5266:Scube2'
ID401702
Institutional Source Beutler Lab
Gene Symbol Scube2
Ensembl Gene ENSMUSG00000007279
Gene Namesignal peptide, CUB domain, EGF-like 2
SynonymsICRFP703N2430Q5.1, 4932442O19Rik, Cegf1, ICRFP703B1614Q5.1
MMRRC Submission 042858-MU
Accession Numbers
Is this an essential gene? Possibly non essential (E-score: 0.371) question?
Stock #R5266 (G1)
Quality Score225
Status Validated
Chromosome7
Chromosomal Location109798676-109865679 bp(-) (GRCm38)
Type of Mutationmissense
DNA Base Change (assembly) C to T at 109809230 bp
ZygosityHeterozygous
Amino Acid Change Glycine to Aspartic acid at position 670 (G670D)
Ref Sequence ENSEMBL: ENSMUSP00000102340 (fasta)
Gene Model predicted gene model for transcript(s): [ENSMUST00000007423] [ENSMUST00000106728] [ENSMUST00000106729]
Predicted Effect probably damaging
Transcript: ENSMUST00000007423
AA Change: G699D

PolyPhen 2 Score 1.000 (Sensitivity: 0.00; Specificity: 1.00)
SMART Domains Protein: ENSMUSP00000007423
Gene: ENSMUSG00000007279
AA Change: G699D

DomainStartEndE-ValueType
signal peptide 1 27 N/A INTRINSIC
EGF_CA 43 83 7.01e-10 SMART
EGF_CA 84 125 1.79e-7 SMART
EGF_CA 126 166 1.5e-9 SMART
EGF 174 212 2.19e-2 SMART
EGF 214 251 4.89e0 SMART
EGF 283 320 5.12e-3 SMART
EGF_CA 321 361 3.7e-9 SMART
EGF_CA 362 400 1.85e-9 SMART
EGF_CA 401 441 2.48e-10 SMART
low complexity region 479 490 N/A INTRINSIC
low complexity region 577 594 N/A INTRINSIC
Pfam:GCC2_GCC3 642 692 7.2e-19 PFAM
Pfam:GCC2_GCC3 699 746 2e-16 PFAM
Pfam:GCC2_GCC3 755 802 3.1e-18 PFAM
CUB 807 919 1.23e-19 SMART
Predicted Effect possibly damaging
Transcript: ENSMUST00000106728
AA Change: G573D

PolyPhen 2 Score 0.946 (Sensitivity: 0.80; Specificity: 0.95)
SMART Domains Protein: ENSMUSP00000102339
Gene: ENSMUSG00000007279
AA Change: G573D

DomainStartEndE-ValueType
signal peptide 1 27 N/A INTRINSIC
EGF_CA 43 83 7.01e-10 SMART
EGF_CA 84 125 1.79e-7 SMART
EGF_CA 126 166 1.5e-9 SMART
EGF 174 212 2.19e-2 SMART
EGF 214 251 4.89e0 SMART
EGF 283 320 5.12e-3 SMART
EGF_CA 321 361 3.7e-9 SMART
EGF_CA 362 400 1.85e-9 SMART
EGF_CA 401 441 2.48e-10 SMART
low complexity region 451 468 N/A INTRINSIC
Pfam:GCC2_GCC3 516 566 6.4e-17 PFAM
Pfam:GCC2_GCC3 573 620 3.5e-14 PFAM
Pfam:GCC2_GCC3 629 676 5.4e-16 PFAM
Blast:CUB 678 727 2e-25 BLAST
Blast:CUB 730 796 1e-37 BLAST
Predicted Effect probably damaging
Transcript: ENSMUST00000106729
AA Change: G670D

PolyPhen 2 Score 1.000 (Sensitivity: 0.00; Specificity: 1.00)
SMART Domains Protein: ENSMUSP00000102340
Gene: ENSMUSG00000007279
AA Change: G670D

DomainStartEndE-ValueType
signal peptide 1 27 N/A INTRINSIC
EGF_CA 43 83 7.01e-10 SMART
EGF_CA 84 125 1.79e-7 SMART
EGF_CA 126 166 1.5e-9 SMART
EGF 174 212 2.19e-2 SMART
EGF 214 251 4.89e0 SMART
EGF 283 320 5.12e-3 SMART
EGF_CA 321 361 3.7e-9 SMART
EGF_CA 362 400 1.85e-9 SMART
EGF_CA 401 441 2.48e-10 SMART
low complexity region 605 622 N/A INTRINSIC
Pfam:GCC2_GCC3 670 717 1.8e-16 PFAM
Pfam:GCC2_GCC3 726 773 2.7e-18 PFAM
CUB 778 890 1.23e-19 SMART
Predicted Effect noncoding transcript
Transcript: ENSMUST00000132113
Predicted Effect noncoding transcript
Transcript: ENSMUST00000138946
Meta Mutation Damage Score 0.9614 question?
Coding Region Coverage
  • 1x: 99.1%
  • 3x: 98.3%
  • 10x: 96.3%
  • 20x: 92.6%
Validation Efficiency 97% (56/58)
MGI Phenotype PHENOTYPE: Mice homozygous for a null mutation are smaller than controls. Mice also exhibit defective endochondral bone formation and impaired Ihh-mediated chondrocyte differentiation. [provided by MGI curators]
Allele List at MGI
Other mutations in this stock
Total: 51 list
GeneRefVarChr/LocMutationPredicted EffectZygosity
4930503L19Rik T C 18: 70,458,384 N457S probably damaging Het
Asic4 G A 1: 75,450,923 G31E probably benign Het
Atp2a3 A G 11: 72,975,397 D281G probably damaging Het
Azin1 T C 15: 38,491,551 D387G probably benign Het
Bdp1 T C 13: 100,067,535 M660V probably benign Het
Catsperg2 G A 7: 29,717,066 T307M probably damaging Het
Cfap54 T G 10: 92,815,902 K3095N probably benign Het
Chl1 A G 6: 103,700,543 N706S probably damaging Het
Crym A G 7: 120,199,294 V113A probably benign Het
Cux1 A G 5: 136,312,694 S607P probably damaging Het
Cyp3a44 T C 5: 145,794,397 N198D possibly damaging Het
Dnase1l1 C T X: 74,277,038 probably null Het
Elac1 A G 18: 73,742,669 V97A probably benign Het
Erbb3 G A 10: 128,569,636 T1251M probably damaging Het
Fam198b T A 3: 79,936,603 N12K probably damaging Het
Gprc5c G T 11: 114,864,267 V257L possibly damaging Het
Hydin A G 8: 110,334,784 H316R possibly damaging Het
Ikzf3 A T 11: 98,490,580 M58K probably benign Het
Lyst T C 13: 13,660,970 Y1746H probably damaging Het
Map3k11 T A 19: 5,700,594 N613K probably benign Het
Mfng C T 15: 78,764,388 R163H probably benign Het
Mrm1 A T 11: 84,819,260 L38Q possibly damaging Het
Myo7b A G 18: 31,998,734 F470L probably damaging Het
Ndst2 G A 14: 20,724,487 R834W probably damaging Het
Olfr1173 T C 2: 88,274,221 Y276C possibly damaging Het
Olfr651 A T 7: 104,553,819 Q300L probably benign Het
Opa1 T A 16: 29,618,130 I637N probably benign Het
Padi4 A G 4: 140,746,131 V665A possibly damaging Het
Pcdh1 A G 18: 38,192,199 Y897H probably damaging Het
Pkp3 A G 7: 141,083,277 D345G probably damaging Het
Pla2g4a T C 1: 149,865,167 M366V possibly damaging Het
Pnkp C T 7: 44,862,403 S113L probably damaging Het
Pon3 T C 6: 5,240,860 D34G possibly damaging Het
Ppargc1b A T 18: 61,315,805 S133T probably damaging Het
Ppp4r3b T C 11: 29,173,309 S2P possibly damaging Het
Rbm20 A G 19: 53,813,387 T109A probably damaging Het
Rexo5 C A 7: 119,844,437 H690Q probably benign Het
Sipa1l2 T C 8: 125,492,126 I157M probably damaging Het
Slbp A T 5: 33,643,866 I167N probably damaging Het
Sry C G Y: 2,662,975 Q228H unknown Het
Stk36 T C 1: 74,611,158 V283A probably benign Het
Tead1 A G 7: 112,759,466 probably benign Het
Tecpr2 G C 12: 110,915,402 W135S probably damaging Het
Tha1 A C 11: 117,869,676 S241A probably damaging Het
Ttc39a A T 4: 109,422,504 I112F probably benign Het
Vmn1r128 A T 7: 21,349,403 T11S probably benign Het
Vnn1 G A 10: 23,903,405 C404Y probably damaging Het
Wdr41 T C 13: 94,995,251 F57L probably damaging Het
Zfp975 T G 7: 42,662,230 T320P probably damaging Het
Zfp985 A T 4: 147,582,832 probably null Het
Zfpm2 T C 15: 41,099,469 S176P probably benign Het
Other mutations in Scube2
AlleleSourceChrCoordTypePredicted EffectPPH Score
IGL00094:Scube2 APN 7 109808454 missense probably damaging 1.00
IGL01608:Scube2 APN 7 109843254 missense probably benign
IGL02080:Scube2 APN 7 109852478 missense probably damaging 1.00
PIT4445001:Scube2 UTSW 7 109809180 missense probably benign 0.22
R0020:Scube2 UTSW 7 109830888 splice site probably benign
R0020:Scube2 UTSW 7 109830888 splice site probably benign
R0106:Scube2 UTSW 7 109846908 splice site probably benign
R0230:Scube2 UTSW 7 109824764 critical splice donor site probably null
R0255:Scube2 UTSW 7 109824872 missense probably damaging 0.98
R0427:Scube2 UTSW 7 109824837 missense probably benign 0.00
R0612:Scube2 UTSW 7 109804764 splice site probably benign
R0658:Scube2 UTSW 7 109837120 splice site probably benign
R0687:Scube2 UTSW 7 109829128 missense possibly damaging 0.47
R1087:Scube2 UTSW 7 109831675 missense probably damaging 1.00
R1366:Scube2 UTSW 7 109804614 missense probably damaging 1.00
R1635:Scube2 UTSW 7 109843214 missense possibly damaging 0.90
R1797:Scube2 UTSW 7 109831675 missense probably damaging 1.00
R1972:Scube2 UTSW 7 109809214 missense probably benign 0.16
R2080:Scube2 UTSW 7 109808505 missense possibly damaging 0.77
R2254:Scube2 UTSW 7 109825459 missense possibly damaging 0.47
R2315:Scube2 UTSW 7 109804701 missense probably damaging 1.00
R2325:Scube2 UTSW 7 109843954 missense probably damaging 1.00
R3723:Scube2 UTSW 7 109808406 splice site probably benign
R3887:Scube2 UTSW 7 109843176 splice site probably benign
R3946:Scube2 UTSW 7 109857590 missense possibly damaging 0.81
R4030:Scube2 UTSW 7 109831771 missense probably benign 0.09
R4621:Scube2 UTSW 7 109800650 missense possibly damaging 0.63
R4684:Scube2 UTSW 7 109810713 missense probably damaging 0.96
R4736:Scube2 UTSW 7 109831205 missense probably benign 0.01
R5096:Scube2 UTSW 7 109799244 utr 3 prime probably benign
R5579:Scube2 UTSW 7 109810737 missense probably damaging 1.00
R5669:Scube2 UTSW 7 109825439 missense probably benign 0.04
R5838:Scube2 UTSW 7 109808444 missense probably damaging 1.00
R5916:Scube2 UTSW 7 109831724 missense possibly damaging 0.77
R6056:Scube2 UTSW 7 109833013 nonsense probably null
R6731:Scube2 UTSW 7 109810737 missense probably damaging 1.00
R6785:Scube2 UTSW 7 109810617 missense probably benign
R8197:Scube2 UTSW 7 109808477 missense possibly damaging 0.53
R8250:Scube2 UTSW 7 109864170 missense probably benign 0.20
R8273:Scube2 UTSW 7 109809176 missense probably benign 0.00
R8427:Scube2 UTSW 7 109800590 missense probably damaging 1.00
Z1177:Scube2 UTSW 7 109838127 missense probably damaging 1.00
Z1177:Scube2 UTSW 7 109843201 missense probably damaging 1.00
Predicted Primers PCR Primer
(F):5'- AAGTGCAGGTAAGTACTCACCTC -3'
(R):5'- TTTGGAAGCAGAGGCCCATC -3'

Sequencing Primer
(F):5'- CTCGGGTTTCACAATCCTGGAAG -3'
(R):5'- CTGTGTGCAAACCTGAGGCATTAC -3'
Posted On2016-07-06