Incidental Mutation 'R5266:Pkp3'
ID401706
Institutional Source Beutler Lab
Gene Symbol Pkp3
Ensembl Gene ENSMUSG00000054065
Gene Nameplakophilin 3
Synonyms
MMRRC Submission 042858-MU
Accession Numbers
Is this an essential gene? Probably non essential (E-score: 0.123) question?
Stock #R5266 (G1)
Quality Score219
Status Validated
Chromosome7
Chromosomal Location141078218-141090510 bp(+) (GRCm38)
Type of Mutationmissense
DNA Base Change (assembly) A to G at 141083277 bp
ZygosityHeterozygous
Amino Acid Change Aspartic acid to Glycine at position 345 (D345G)
Ref Sequence ENSEMBL: ENSMUSP00000101654 (fasta)
Gene Model predicted gene model for transcript(s): [ENSMUST00000066873] [ENSMUST00000106039] [ENSMUST00000159375] [ENSMUST00000160869] [ENSMUST00000163041]
Predicted Effect probably damaging
Transcript: ENSMUST00000066873
AA Change: D320G

PolyPhen 2 Score 1.000 (Sensitivity: 0.00; Specificity: 1.00)
SMART Domains Protein: ENSMUSP00000069961
Gene: ENSMUSG00000054065
AA Change: D320G

DomainStartEndE-ValueType
low complexity region 40 54 N/A INTRINSIC
low complexity region 139 150 N/A INTRINSIC
low complexity region 179 194 N/A INTRINSIC
low complexity region 219 228 N/A INTRINSIC
ARM 350 390 8.11e-5 SMART
ARM 392 432 3.24e-4 SMART
ARM 489 536 3.85e0 SMART
internal_repeat_1 605 702 2.91e-9 PROSPERO
low complexity region 717 731 N/A INTRINSIC
low complexity region 757 774 N/A INTRINSIC
Predicted Effect probably damaging
Transcript: ENSMUST00000106039
AA Change: D345G

PolyPhen 2 Score 1.000 (Sensitivity: 0.00; Specificity: 1.00)
SMART Domains Protein: ENSMUSP00000101654
Gene: ENSMUSG00000054065
AA Change: D345G

DomainStartEndE-ValueType
low complexity region 65 79 N/A INTRINSIC
low complexity region 164 175 N/A INTRINSIC
low complexity region 204 219 N/A INTRINSIC
low complexity region 244 253 N/A INTRINSIC
ARM 375 415 8.11e-5 SMART
ARM 417 457 3.24e-4 SMART
ARM 514 561 3.85e0 SMART
internal_repeat_1 630 727 4.99e-9 PROSPERO
low complexity region 742 756 N/A INTRINSIC
low complexity region 782 799 N/A INTRINSIC
Predicted Effect noncoding transcript
Transcript: ENSMUST00000159253
Predicted Effect probably benign
Transcript: ENSMUST00000159375
Predicted Effect noncoding transcript
Transcript: ENSMUST00000160403
Predicted Effect noncoding transcript
Transcript: ENSMUST00000160615
Predicted Effect probably benign
Transcript: ENSMUST00000160869
SMART Domains Protein: ENSMUSP00000124013
Gene: ENSMUSG00000054065

DomainStartEndE-ValueType
low complexity region 40 54 N/A INTRINSIC
Predicted Effect probably benign
Transcript: ENSMUST00000163041
SMART Domains Protein: ENSMUSP00000124434
Gene: ENSMUSG00000054065

DomainStartEndE-ValueType
low complexity region 61 72 N/A INTRINSIC
low complexity region 101 116 N/A INTRINSIC
low complexity region 141 150 N/A INTRINSIC
Meta Mutation Damage Score 0.6079 question?
Coding Region Coverage
  • 1x: 99.1%
  • 3x: 98.3%
  • 10x: 96.3%
  • 20x: 92.6%
Validation Efficiency 97% (56/58)
MGI Phenotype FUNCTION: [Summary is not available for the mouse gene. This summary is for the human ortholog.] This gene encodes a member of the arm-repeat (armadillo) and plakophilin gene families. Plakophilin proteins contain numerous armadillo repeats, localize to cell desmosomes and nuclei, and participate in linking cadherins to intermediate filaments in the cytoskeleton. This protein may act in cellular desmosome-dependent adhesion and signaling pathways. Two transcript variants encoding different isoforms have been found for this gene. [provided by RefSeq, Dec 2014]
PHENOTYPE: Mice homozygous for a null allele exhibit retarded hair growth, epidermal thickening and abnormal hair follicles that lead to secondary alopecia and acute dermatitis. [provided by MGI curators]
Allele List at MGI
Other mutations in this stock
Total: 51 list
GeneRefVarChr/LocMutationPredicted EffectZygosity
4930503L19Rik T C 18: 70,458,384 N457S probably damaging Het
Asic4 G A 1: 75,450,923 G31E probably benign Het
Atp2a3 A G 11: 72,975,397 D281G probably damaging Het
Azin1 T C 15: 38,491,551 D387G probably benign Het
Bdp1 T C 13: 100,067,535 M660V probably benign Het
Catsperg2 G A 7: 29,717,066 T307M probably damaging Het
Cfap54 T G 10: 92,815,902 K3095N probably benign Het
Chl1 A G 6: 103,700,543 N706S probably damaging Het
Crym A G 7: 120,199,294 V113A probably benign Het
Cux1 A G 5: 136,312,694 S607P probably damaging Het
Cyp3a44 T C 5: 145,794,397 N198D possibly damaging Het
Dnase1l1 C T X: 74,277,038 probably null Het
Elac1 A G 18: 73,742,669 V97A probably benign Het
Erbb3 G A 10: 128,569,636 T1251M probably damaging Het
Fam198b T A 3: 79,936,603 N12K probably damaging Het
Gprc5c G T 11: 114,864,267 V257L possibly damaging Het
Hydin A G 8: 110,334,784 H316R possibly damaging Het
Ikzf3 A T 11: 98,490,580 M58K probably benign Het
Lyst T C 13: 13,660,970 Y1746H probably damaging Het
Map3k11 T A 19: 5,700,594 N613K probably benign Het
Mfng C T 15: 78,764,388 R163H probably benign Het
Mrm1 A T 11: 84,819,260 L38Q possibly damaging Het
Myo7b A G 18: 31,998,734 F470L probably damaging Het
Ndst2 G A 14: 20,724,487 R834W probably damaging Het
Olfr1173 T C 2: 88,274,221 Y276C possibly damaging Het
Olfr651 A T 7: 104,553,819 Q300L probably benign Het
Opa1 T A 16: 29,618,130 I637N probably benign Het
Padi4 A G 4: 140,746,131 V665A possibly damaging Het
Pcdh1 A G 18: 38,192,199 Y897H probably damaging Het
Pla2g4a T C 1: 149,865,167 M366V possibly damaging Het
Pnkp C T 7: 44,862,403 S113L probably damaging Het
Pon3 T C 6: 5,240,860 D34G possibly damaging Het
Ppargc1b A T 18: 61,315,805 S133T probably damaging Het
Ppp4r3b T C 11: 29,173,309 S2P possibly damaging Het
Rbm20 A G 19: 53,813,387 T109A probably damaging Het
Rexo5 C A 7: 119,844,437 H690Q probably benign Het
Scube2 C T 7: 109,809,230 G670D probably damaging Het
Sipa1l2 T C 8: 125,492,126 I157M probably damaging Het
Slbp A T 5: 33,643,866 I167N probably damaging Het
Sry C G Y: 2,662,975 Q228H unknown Het
Stk36 T C 1: 74,611,158 V283A probably benign Het
Tead1 A G 7: 112,759,466 probably benign Het
Tecpr2 G C 12: 110,915,402 W135S probably damaging Het
Tha1 A C 11: 117,869,676 S241A probably damaging Het
Ttc39a A T 4: 109,422,504 I112F probably benign Het
Vmn1r128 A T 7: 21,349,403 T11S probably benign Het
Vnn1 G A 10: 23,903,405 C404Y probably damaging Het
Wdr41 T C 13: 94,995,251 F57L probably damaging Het
Zfp975 T G 7: 42,662,230 T320P probably damaging Het
Zfp985 A T 4: 147,582,832 probably null Het
Zfpm2 T C 15: 41,099,469 S176P probably benign Het
Other mutations in Pkp3
AlleleSourceChrCoordTypePredicted EffectPPH Score
IGL01120:Pkp3 APN 7 141084182 nonsense probably null
IGL01367:Pkp3 APN 7 141084076 missense probably damaging 1.00
IGL01793:Pkp3 APN 7 141088904 missense probably benign 0.01
IGL02140:Pkp3 APN 7 141089336 missense probably damaging 1.00
IGL02231:Pkp3 APN 7 141084238 missense probably damaging 1.00
IGL02708:Pkp3 APN 7 141089768 unclassified probably benign
IGL02755:Pkp3 APN 7 141088405 splice site probably null
IGL03017:Pkp3 APN 7 141083370 missense probably benign 0.12
IGL03351:Pkp3 APN 7 141082693 missense probably benign
PIT4514001:Pkp3 UTSW 7 141089710 missense probably damaging 0.99
R0145:Pkp3 UTSW 7 141089763 critical splice donor site probably null
R0153:Pkp3 UTSW 7 141083343 missense probably damaging 1.00
R0184:Pkp3 UTSW 7 141088367 missense probably benign 0.41
R1014:Pkp3 UTSW 7 141082826 missense probably benign 0.03
R1664:Pkp3 UTSW 7 141087647 missense probably damaging 1.00
R1844:Pkp3 UTSW 7 141088502 missense probably damaging 1.00
R1891:Pkp3 UTSW 7 141084056 unclassified probably null
R2100:Pkp3 UTSW 7 141083292 missense probably damaging 1.00
R3772:Pkp3 UTSW 7 141082346 start codon destroyed probably null
R4003:Pkp3 UTSW 7 141088737 critical splice acceptor site probably null
R4089:Pkp3 UTSW 7 141084143 missense probably damaging 1.00
R4670:Pkp3 UTSW 7 141082699 missense probably benign 0.00
R5619:Pkp3 UTSW 7 141088506 missense probably damaging 1.00
R6113:Pkp3 UTSW 7 141082656 missense probably damaging 0.97
R6820:Pkp3 UTSW 7 141079844 critical splice donor site probably null
R7650:Pkp3 UTSW 7 141082370 missense probably benign 0.00
R7662:Pkp3 UTSW 7 141078379 missense probably benign 0.03
X0028:Pkp3 UTSW 7 141089948 splice site probably null
Predicted Primers PCR Primer
(F):5'- TCTTAGCCTGGCTGACTCAG -3'
(R):5'- GGGCTAAGGACCATAGTTCAGG -3'

Sequencing Primer
(F):5'- ATCGAACCCTGCAGAGG -3'
(R):5'- TAGTCACTGGGGGTATCAGAGCC -3'
Posted On2016-07-06