Incidental Mutation 'R5266:Vnn1'
ID401709
Institutional Source Beutler Lab
Gene Symbol Vnn1
Ensembl Gene ENSMUSG00000037440
Gene Namevanin 1
SynonymsV-1, pantetheinase
MMRRC Submission 042858-MU
Accession Numbers
Is this an essential gene? Probably non essential (E-score: 0.148) question?
Stock #R5266 (G1)
Quality Score225
Status Validated
Chromosome10
Chromosomal Location23894688-23905343 bp(+) (GRCm38)
Type of Mutationmissense
DNA Base Change (assembly) G to A at 23903405 bp
ZygosityHeterozygous
Amino Acid Change Cysteine to Tyrosine at position 404 (C404Y)
Ref Sequence ENSEMBL: ENSMUSP00000040599 (fasta)
Gene Model predicted gene model for transcript(s): [ENSMUST00000041416]
Predicted Effect probably damaging
Transcript: ENSMUST00000041416
AA Change: C404Y

PolyPhen 2 Score 0.995 (Sensitivity: 0.68; Specificity: 0.97)
SMART Domains Protein: ENSMUSP00000040599
Gene: ENSMUSG00000037440
AA Change: C404Y

DomainStartEndE-ValueType
signal peptide 1 23 N/A INTRINSIC
Pfam:CN_hydrolase 52 279 2.5e-19 PFAM
Predicted Effect noncoding transcript
Transcript: ENSMUST00000219254
Meta Mutation Damage Score 0.8843 question?
Coding Region Coverage
  • 1x: 99.1%
  • 3x: 98.3%
  • 10x: 96.3%
  • 20x: 92.6%
Validation Efficiency 97% (56/58)
MGI Phenotype FUNCTION: [Summary is not available for the mouse gene. This summary is for the human ortholog.] This gene encodes a member of the vanin family of proteins, which share extensive sequence similarity with each other, and also with biotinidase. The family includes secreted and membrane-associated proteins, a few of which have been reported to participate in hematopoietic cell trafficking. No biotinidase activity has been demonstrated for any of the vanin proteins, however, they possess pantetheinase activity, which may play a role in oxidative-stress response. This protein, like its mouse homolog, is likely a GPI-anchored cell surface molecule. The mouse protein is expressed by the perivascular thymic stromal cells and regulates migration of T-cell progenitors to the thymus. This gene lies in close proximity to, and in the same transcriptional orientation as, two other vanin genes on chromosome 6q23-q24. [provided by RefSeq, Feb 2009]
PHENOTYPE: Mice homozygous for disruptions of this gene develop normally and so no abnormalities in the maturation of lymphoid organs. However, membrane bound pantetheinase is absent in livers and kidneys resuulting in an absence of cysteamine in these organs. [provided by MGI curators]
Allele List at MGI
Other mutations in this stock
Total: 51 list
GeneRefVarChr/LocMutationPredicted EffectZygosity
4930503L19Rik T C 18: 70,458,384 N457S probably damaging Het
Asic4 G A 1: 75,450,923 G31E probably benign Het
Atp2a3 A G 11: 72,975,397 D281G probably damaging Het
Azin1 T C 15: 38,491,551 D387G probably benign Het
Bdp1 T C 13: 100,067,535 M660V probably benign Het
Catsperg2 G A 7: 29,717,066 T307M probably damaging Het
Cfap54 T G 10: 92,815,902 K3095N probably benign Het
Chl1 A G 6: 103,700,543 N706S probably damaging Het
Crym A G 7: 120,199,294 V113A probably benign Het
Cux1 A G 5: 136,312,694 S607P probably damaging Het
Cyp3a44 T C 5: 145,794,397 N198D possibly damaging Het
Dnase1l1 C T X: 74,277,038 probably null Het
Elac1 A G 18: 73,742,669 V97A probably benign Het
Erbb3 G A 10: 128,569,636 T1251M probably damaging Het
Fam198b T A 3: 79,936,603 N12K probably damaging Het
Gprc5c G T 11: 114,864,267 V257L possibly damaging Het
Hydin A G 8: 110,334,784 H316R possibly damaging Het
Ikzf3 A T 11: 98,490,580 M58K probably benign Het
Lyst T C 13: 13,660,970 Y1746H probably damaging Het
Map3k11 T A 19: 5,700,594 N613K probably benign Het
Mfng C T 15: 78,764,388 R163H probably benign Het
Mrm1 A T 11: 84,819,260 L38Q possibly damaging Het
Myo7b A G 18: 31,998,734 F470L probably damaging Het
Ndst2 G A 14: 20,724,487 R834W probably damaging Het
Olfr1173 T C 2: 88,274,221 Y276C possibly damaging Het
Olfr651 A T 7: 104,553,819 Q300L probably benign Het
Opa1 T A 16: 29,618,130 I637N probably benign Het
Padi4 A G 4: 140,746,131 V665A possibly damaging Het
Pcdh1 A G 18: 38,192,199 Y897H probably damaging Het
Pkp3 A G 7: 141,083,277 D345G probably damaging Het
Pla2g4a T C 1: 149,865,167 M366V possibly damaging Het
Pnkp C T 7: 44,862,403 S113L probably damaging Het
Pon3 T C 6: 5,240,860 D34G possibly damaging Het
Ppargc1b A T 18: 61,315,805 S133T probably damaging Het
Ppp4r3b T C 11: 29,173,309 S2P possibly damaging Het
Rbm20 A G 19: 53,813,387 T109A probably damaging Het
Rexo5 C A 7: 119,844,437 H690Q probably benign Het
Scube2 C T 7: 109,809,230 G670D probably damaging Het
Sipa1l2 T C 8: 125,492,126 I157M probably damaging Het
Slbp A T 5: 33,643,866 I167N probably damaging Het
Sry C G Y: 2,662,975 Q228H unknown Het
Stk36 T C 1: 74,611,158 V283A probably benign Het
Tead1 A G 7: 112,759,466 probably benign Het
Tecpr2 G C 12: 110,915,402 W135S probably damaging Het
Tha1 A C 11: 117,869,676 S241A probably damaging Het
Ttc39a A T 4: 109,422,504 I112F probably benign Het
Vmn1r128 A T 7: 21,349,403 T11S probably benign Het
Wdr41 T C 13: 94,995,251 F57L probably damaging Het
Zfp975 T G 7: 42,662,230 T320P probably damaging Het
Zfp985 A T 4: 147,582,832 probably null Het
Zfpm2 T C 15: 41,099,469 S176P probably benign Het
Other mutations in Vnn1
AlleleSourceChrCoordTypePredicted EffectPPH Score
IGL00838:Vnn1 APN 10 23900779 missense possibly damaging 0.51
IGL01299:Vnn1 APN 10 23895051 missense probably damaging 1.00
IGL01353:Vnn1 APN 10 23900840 missense probably damaging 1.00
IGL01774:Vnn1 APN 10 23900710 missense probably benign 0.26
IGL01970:Vnn1 APN 10 23897402 missense probably benign 0.06
IGL01985:Vnn1 APN 10 23900744 missense probably benign 0.00
IGL02019:Vnn1 APN 10 23903551 missense possibly damaging 0.69
IGL02198:Vnn1 APN 10 23903425 missense probably benign 0.00
IGL02349:Vnn1 APN 10 23898503 missense possibly damaging 0.91
IGL02738:Vnn1 APN 10 23904622 missense probably benign 0.00
IGL03058:Vnn1 APN 10 23904544 missense probably benign 0.06
R0008:Vnn1 UTSW 10 23898602 critical splice donor site probably null
R0030:Vnn1 UTSW 10 23900846 missense probably benign 0.08
R0508:Vnn1 UTSW 10 23895012 missense probably benign 0.01
R0781:Vnn1 UTSW 10 23899601 missense possibly damaging 0.46
R1110:Vnn1 UTSW 10 23899601 missense possibly damaging 0.46
R1757:Vnn1 UTSW 10 23900828 missense possibly damaging 0.49
R1757:Vnn1 UTSW 10 23900829 missense probably benign 0.00
R1778:Vnn1 UTSW 10 23899517 missense possibly damaging 0.67
R2011:Vnn1 UTSW 10 23894971 nonsense probably null
R2055:Vnn1 UTSW 10 23900577 splice site probably benign
R2158:Vnn1 UTSW 10 23900755 nonsense probably null
R2186:Vnn1 UTSW 10 23897401 missense probably benign 0.29
R4277:Vnn1 UTSW 10 23898512 missense possibly damaging 0.89
R4279:Vnn1 UTSW 10 23898512 missense possibly damaging 0.89
R4473:Vnn1 UTSW 10 23894891 missense probably benign
R4590:Vnn1 UTSW 10 23899405 missense possibly damaging 0.61
R4708:Vnn1 UTSW 10 23897352 missense probably benign 0.01
R4794:Vnn1 UTSW 10 23900704 missense probably benign 0.01
R5495:Vnn1 UTSW 10 23898564 missense probably damaging 0.98
R6064:Vnn1 UTSW 10 23894909 missense probably benign 0.05
R7081:Vnn1 UTSW 10 23895005 missense possibly damaging 0.66
R7088:Vnn1 UTSW 10 23900747 missense probably benign 0.00
R7221:Vnn1 UTSW 10 23895054 missense probably benign 0.07
R7334:Vnn1 UTSW 10 23900760 missense probably benign 0.04
R8784:Vnn1 UTSW 10 23904628 missense probably benign
Predicted Primers PCR Primer
(F):5'- CCCACTAAAGATGCAGAGGG -3'
(R):5'- ATCAAGCGGAGAGTGTTACC -3'

Sequencing Primer
(F):5'- GCGGCCCTGATTATAAAGTTCAGC -3'
(R):5'- GGAGAGTGTTACCTGAAACTCCC -3'
Posted On2016-07-06