Incidental Mutation 'R0414:Gab1'
ID40171
Institutional Source Beutler Lab
Gene Symbol Gab1
Ensembl Gene ENSMUSG00000031714
Gene Namegrowth factor receptor bound protein 2-associated protein 1
Synonyms
MMRRC Submission 038616-MU
Accession Numbers

Genbank: NM_021356; MGI: 108088

Is this an essential gene? Essential (E-score: 1.000) question?
Stock #R0414 (G1)
Quality Score225
Status Validated
Chromosome8
Chromosomal Location80764438-80880519 bp(-) (GRCm38)
Type of Mutationmissense
DNA Base Change (assembly) A to G at 80800289 bp
ZygosityHeterozygous
Amino Acid Change Isoleucine to Threonine at position 60 (I60T)
Ref Sequence ENSEMBL: ENSMUSP00000147784 (fasta)
Gene Model predicted gene model for transcript(s): [ENSMUST00000034150] [ENSMUST00000210676]
Predicted Effect probably damaging
Transcript: ENSMUST00000034150
AA Change: I60T

PolyPhen 2 Score 0.998 (Sensitivity: 0.27; Specificity: 0.99)
SMART Domains Protein: ENSMUSP00000034150
Gene: ENSMUSG00000031714
AA Change: I60T

DomainStartEndE-ValueType
PH 6 118 1.16e-23 SMART
low complexity region 336 354 N/A INTRINSIC
low complexity region 572 586 N/A INTRINSIC
Predicted Effect probably damaging
Transcript: ENSMUST00000210676
AA Change: I60T

PolyPhen 2 Score 1.000 (Sensitivity: 0.00; Specificity: 1.00)
Predicted Effect noncoding transcript
Transcript: ENSMUST00000211018
Meta Mutation Damage Score 0.328 question?
Coding Region Coverage
  • 1x: 99.1%
  • 3x: 98.4%
  • 10x: 96.6%
  • 20x: 93.6%
Validation Efficiency 96% (64/67)
MGI Phenotype FUNCTION: [Summary is not available for the mouse gene. This summary is for the human ortholog.] The protein encoded by this gene is a member of the IRS1-like multisubstrate docking protein family. It is an important mediator of branching tubulogenesis and plays a central role in cellular growth response, transformation and apoptosis. Two transcript variants encoding different isoforms have been found for this gene. [provided by RefSeq, Aug 2008]
PHENOTYPE: Homozygotes for targeted null mutations exhibit developmental defects in the placenta, heart, eye, muscle, and skin, and die between embryonic day 13.5 and 18.5. [provided by MGI curators]
Allele List at MGI

All alleles(43) : Targeted, knock-out(1) Targeted, other(8) Gene trapped(34)

Other mutations in this stock
Total: 58 list
GeneRefVarChr/LocMutationPredicted EffectZygosity
1700016H13Rik A T 5: 103,649,490 V51E probably benign Het
4922502D21Rik T C 6: 129,326,850 probably benign Het
Abo T C 2: 26,843,416 Y259C probably damaging Het
Adamts5 A G 16: 85,877,906 S457P probably damaging Het
Alk G T 17: 71,899,286 probably benign Het
Alpk2 A G 18: 65,306,159 I1188T probably benign Het
Ambra1 T C 2: 91,875,739 S730P possibly damaging Het
Arhgef2 T C 3: 88,632,268 probably benign Het
B3gnt7 T C 1: 86,305,629 I82T probably damaging Het
B4galnt3 T C 6: 120,216,565 D400G probably benign Het
Bag4 A G 8: 25,767,997 V434A possibly damaging Het
BC055324 T C 1: 163,968,321 I434V probably benign Het
Cfc1 A G 1: 34,537,328 D130G probably damaging Het
Chd4 T C 6: 125,107,480 Y692H probably damaging Het
Cilp2 A G 8: 69,882,993 S452P probably benign Het
Crybg2 GAGAAGAAG GAGAAG 4: 134,072,636 probably benign Het
Dnah2 T C 11: 69,499,238 D727G probably benign Het
Dock10 C A 1: 80,535,933 V1129F possibly damaging Het
Dsc1 A T 18: 20,088,354 I688N possibly damaging Het
Dyrk1a C G 16: 94,663,842 T103R probably damaging Het
Ebf1 C T 11: 44,924,470 R304* probably null Het
Eif2s2 A G 2: 154,884,461 probably benign Het
Endov T G 11: 119,499,571 Y8* probably null Het
Eps15 T A 4: 109,366,480 D485E probably damaging Het
Fam118a C A 15: 85,045,689 S39R probably damaging Het
Fam173b T A 15: 31,617,002 Y126* probably null Het
Fbxo22 T A 9: 55,223,626 M393K possibly damaging Het
Gapvd1 A G 2: 34,693,427 L1059P probably benign Het
Gbp5 A G 3: 142,507,913 probably null Het
Glb1l2 T A 9: 26,765,104 K487* probably null Het
Hist1h1a A G 13: 23,764,158 probably benign Het
Hmcn1 T C 1: 150,715,822 I1875M possibly damaging Het
Jkamp T C 12: 72,094,145 probably null Het
Kprp C T 3: 92,825,713 C10Y probably damaging Het
Lrig2 A G 3: 104,494,056 probably null Het
Lrrn3 T A 12: 41,453,940 N126I probably damaging Het
Mug1 T C 6: 121,856,554 F325L probably benign Het
Myadm AC ACC 7: 3,296,760 probably null Het
Nagk C T 6: 83,797,267 R87* probably null Het
Nipal4 T A 11: 46,161,908 I77F probably damaging Het
Olfr1217 A G 2: 89,023,146 Y286H probably damaging Het
Osbp2 T C 11: 3,819,932 H250R probably damaging Het
Pcx T C 19: 4,607,642 V378A possibly damaging Het
Pfkp T A 13: 6,593,210 H524L probably benign Het
Picalm A T 7: 90,189,198 N370I possibly damaging Het
Plcl2 A C 17: 50,607,955 D664A possibly damaging Het
Ptpn5 G A 7: 47,083,136 P320S probably benign Het
Scn3a T A 2: 65,525,982 probably benign Het
Sfswap A G 5: 129,504,051 D96G possibly damaging Het
Slfn1 A G 11: 83,121,270 I71V probably benign Het
Spata1 A G 3: 146,476,188 probably null Het
Stx18 T C 5: 38,105,005 probably benign Het
Suox T A 10: 128,671,457 H234L probably benign Het
Tbc1d17 T C 7: 44,846,059 S114G probably benign Het
Tfeb T A 17: 47,788,299 probably null Het
Tnks A C 8: 34,853,309 V736G probably damaging Het
Wdhd1 T C 14: 47,276,588 T4A probably benign Het
Wdr66 A G 5: 123,287,413 probably null Het
Other mutations in Gab1
AlleleSourceChrCoordTypePredicted EffectPPH Score
IGL01679:Gab1 APN 8 80791549 missense probably benign 0.00
IGL02610:Gab1 APN 8 80800099 critical splice donor site probably null
IGL02661:Gab1 APN 8 80788937 missense probably damaging 1.00
IGL02716:Gab1 APN 8 80769694 missense probably damaging 1.00
D3080:Gab1 UTSW 8 80766378 missense probably damaging 1.00
R0006:Gab1 UTSW 8 80769730 missense possibly damaging 0.56
R0144:Gab1 UTSW 8 80785201 splice site probably benign
R0173:Gab1 UTSW 8 80800160 missense possibly damaging 0.68
R0503:Gab1 UTSW 8 80800142 missense probably damaging 1.00
R0675:Gab1 UTSW 8 80769668 missense probably damaging 1.00
R0690:Gab1 UTSW 8 80800116 missense probably damaging 1.00
R1068:Gab1 UTSW 8 80800172 missense possibly damaging 0.95
R1175:Gab1 UTSW 8 80784842 missense probably damaging 0.99
R1240:Gab1 UTSW 8 80788530 missense probably damaging 1.00
R1430:Gab1 UTSW 8 80788612 missense probably benign 0.34
R1656:Gab1 UTSW 8 80788759 missense probably damaging 1.00
R1986:Gab1 UTSW 8 80766381 missense probably damaging 1.00
R2860:Gab1 UTSW 8 80784753 missense probably benign 0.32
R2861:Gab1 UTSW 8 80784753 missense probably benign 0.32
R4683:Gab1 UTSW 8 80788632 missense probably benign 0.34
R4726:Gab1 UTSW 8 80789053 missense possibly damaging 0.80
R5425:Gab1 UTSW 8 80800389 missense probably damaging 1.00
R5684:Gab1 UTSW 8 80769670 missense probably damaging 1.00
R6195:Gab1 UTSW 8 80879532 nonsense probably null
R6217:Gab1 UTSW 8 80791608 missense possibly damaging 0.48
R6233:Gab1 UTSW 8 80879532 nonsense probably null
R6407:Gab1 UTSW 8 80788597 missense possibly damaging 0.77
R6408:Gab1 UTSW 8 80788597 missense possibly damaging 0.77
R6415:Gab1 UTSW 8 80788597 missense possibly damaging 0.77
R6418:Gab1 UTSW 8 80788597 missense possibly damaging 0.77
R6479:Gab1 UTSW 8 80788597 missense possibly damaging 0.77
R7019:Gab1 UTSW 8 80784817 missense probably damaging 0.99
R7291:Gab1 UTSW 8 80800151 missense probably damaging 1.00
R7432:Gab1 UTSW 8 80788669 missense probably benign 0.20
X0066:Gab1 UTSW 8 80879564 nonsense probably null
Predicted Primers PCR Primer
(F):5'- ACAACGGACCCACTTGTTCATGTC -3'
(R):5'- GCTGATACCGTTTCCCCAACGTTAC -3'

Sequencing Primer
(F):5'- CTTCCTCACTATCTGCCACCAAG -3'
(R):5'- CCATTTGCTGTGTCATAAGAGAACTG -3'
Posted On2013-05-23