Incidental Mutation 'R5266:Mrm1'
ID401715
Institutional Source Beutler Lab
Gene Symbol Mrm1
Ensembl Gene ENSMUSG00000018405
Gene Namemitochondrial rRNA methyltransferase 1
Synonyms
MMRRC Submission 042858-MU
Accession Numbers
Is this an essential gene? Probably non essential (E-score: 0.145) question?
Stock #R5266 (G1)
Quality Score146
Status Validated
Chromosome11
Chromosomal Location84813061-84819515 bp(-) (GRCm38)
Type of Mutationmissense
DNA Base Change (assembly) A to T at 84819260 bp
ZygosityHeterozygous
Amino Acid Change Leucine to Glutamine at position 38 (L38Q)
Ref Sequence ENSEMBL: ENSMUSP00000018549 (fasta)
Gene Model predicted gene model for transcript(s): [ENSMUST00000018549] [ENSMUST00000047560] [ENSMUST00000151496]
Predicted Effect possibly damaging
Transcript: ENSMUST00000018549
AA Change: L38Q

PolyPhen 2 Score 0.584 (Sensitivity: 0.88; Specificity: 0.91)
SMART Domains Protein: ENSMUSP00000018549
Gene: ENSMUSG00000018405
AA Change: L38Q

DomainStartEndE-ValueType
SpoU_sub_bind 49 127 3.31e-11 SMART
Pfam:SpoU_methylase 143 299 3.2e-31 PFAM
Predicted Effect probably benign
Transcript: ENSMUST00000047560
SMART Domains Protein: ENSMUSP00000043467
Gene: ENSMUSG00000034449

DomainStartEndE-ValueType
Pfam:adh_short 12 214 1.4e-46 PFAM
Pfam:KR 13 154 1.7e-11 PFAM
Pfam:Epimerase 14 251 4.8e-7 PFAM
Pfam:adh_short_C2 18 245 1.8e-16 PFAM
Predicted Effect noncoding transcript
Transcript: ENSMUST00000139076
Predicted Effect noncoding transcript
Transcript: ENSMUST00000144104
Predicted Effect probably benign
Transcript: ENSMUST00000151496
SMART Domains Protein: ENSMUSP00000122267
Gene: ENSMUSG00000034449

DomainStartEndE-ValueType
Pfam:adh_short 12 49 6.3e-8 PFAM
Meta Mutation Damage Score 0.1468 question?
Coding Region Coverage
  • 1x: 99.1%
  • 3x: 98.3%
  • 10x: 96.3%
  • 20x: 92.6%
Validation Efficiency 97% (56/58)
Allele List at MGI
Other mutations in this stock
Total: 51 list
GeneRefVarChr/LocMutationPredicted EffectZygosity
4930503L19Rik T C 18: 70,458,384 N457S probably damaging Het
Asic4 G A 1: 75,450,923 G31E probably benign Het
Atp2a3 A G 11: 72,975,397 D281G probably damaging Het
Azin1 T C 15: 38,491,551 D387G probably benign Het
Bdp1 T C 13: 100,067,535 M660V probably benign Het
Catsperg2 G A 7: 29,717,066 T307M probably damaging Het
Cfap54 T G 10: 92,815,902 K3095N probably benign Het
Chl1 A G 6: 103,700,543 N706S probably damaging Het
Crym A G 7: 120,199,294 V113A probably benign Het
Cux1 A G 5: 136,312,694 S607P probably damaging Het
Cyp3a44 T C 5: 145,794,397 N198D possibly damaging Het
Dnase1l1 C T X: 74,277,038 probably null Het
Elac1 A G 18: 73,742,669 V97A probably benign Het
Erbb3 G A 10: 128,569,636 T1251M probably damaging Het
Fam198b T A 3: 79,936,603 N12K probably damaging Het
Gprc5c G T 11: 114,864,267 V257L possibly damaging Het
Hydin A G 8: 110,334,784 H316R possibly damaging Het
Ikzf3 A T 11: 98,490,580 M58K probably benign Het
Lyst T C 13: 13,660,970 Y1746H probably damaging Het
Map3k11 T A 19: 5,700,594 N613K probably benign Het
Mfng C T 15: 78,764,388 R163H probably benign Het
Myo7b A G 18: 31,998,734 F470L probably damaging Het
Ndst2 G A 14: 20,724,487 R834W probably damaging Het
Olfr1173 T C 2: 88,274,221 Y276C possibly damaging Het
Olfr651 A T 7: 104,553,819 Q300L probably benign Het
Opa1 T A 16: 29,618,130 I637N probably benign Het
Padi4 A G 4: 140,746,131 V665A possibly damaging Het
Pcdh1 A G 18: 38,192,199 Y897H probably damaging Het
Pkp3 A G 7: 141,083,277 D345G probably damaging Het
Pla2g4a T C 1: 149,865,167 M366V possibly damaging Het
Pnkp C T 7: 44,862,403 S113L probably damaging Het
Pon3 T C 6: 5,240,860 D34G possibly damaging Het
Ppargc1b A T 18: 61,315,805 S133T probably damaging Het
Ppp4r3b T C 11: 29,173,309 S2P possibly damaging Het
Rbm20 A G 19: 53,813,387 T109A probably damaging Het
Rexo5 C A 7: 119,844,437 H690Q probably benign Het
Scube2 C T 7: 109,809,230 G670D probably damaging Het
Sipa1l2 T C 8: 125,492,126 I157M probably damaging Het
Slbp A T 5: 33,643,866 I167N probably damaging Het
Sry C G Y: 2,662,975 Q228H unknown Het
Stk36 T C 1: 74,611,158 V283A probably benign Het
Tead1 A G 7: 112,759,466 probably benign Het
Tecpr2 G C 12: 110,915,402 W135S probably damaging Het
Tha1 A C 11: 117,869,676 S241A probably damaging Het
Ttc39a A T 4: 109,422,504 I112F probably benign Het
Vmn1r128 A T 7: 21,349,403 T11S probably benign Het
Vnn1 G A 10: 23,903,405 C404Y probably damaging Het
Wdr41 T C 13: 94,995,251 F57L probably damaging Het
Zfp975 T G 7: 42,662,230 T320P probably damaging Het
Zfp985 A T 4: 147,582,832 probably null Het
Zfpm2 T C 15: 41,099,469 S176P probably benign Het
Other mutations in Mrm1
AlleleSourceChrCoordTypePredicted EffectPPH Score
R0226:Mrm1 UTSW 11 84819170 missense possibly damaging 0.73
R0257:Mrm1 UTSW 11 84814823 splice site probably benign
R0381:Mrm1 UTSW 11 84818683 missense possibly damaging 0.91
R0563:Mrm1 UTSW 11 84814713 missense probably damaging 1.00
R0715:Mrm1 UTSW 11 84814813 splice site probably benign
R1710:Mrm1 UTSW 11 84818692 missense probably damaging 1.00
R4402:Mrm1 UTSW 11 84819089 missense probably damaging 1.00
R4413:Mrm1 UTSW 11 84819228 missense possibly damaging 0.46
R5930:Mrm1 UTSW 11 84819192 missense probably damaging 1.00
R7833:Mrm1 UTSW 11 84818643 missense probably damaging 1.00
R7916:Mrm1 UTSW 11 84818643 missense probably damaging 1.00
X0017:Mrm1 UTSW 11 84814923 missense possibly damaging 0.83
Predicted Primers PCR Primer
(F):5'- CATCCAGTTTCTGACGCCTG -3'
(R):5'- AAGGTTAGCTCAGCACCAG -3'

Sequencing Primer
(F):5'- GCCTCAAGACAGGGATGC -3'
(R):5'- TGCGACTCACTCCTGTAGG -3'
Posted On2016-07-06