Incidental Mutation 'R5266:Ikzf3'
ID401716
Institutional Source Beutler Lab
Gene Symbol Ikzf3
Ensembl Gene ENSMUSG00000018168
Gene NameIKAROS family zinc finger 3
SynonymsZfpn1a3, Aiolos, 5830411O07Rik
MMRRC Submission 042858-MU
Accession Numbers
Is this an essential gene? Non essential (E-score: 0.000) question?
Stock #R5266 (G1)
Quality Score225
Status Validated
Chromosome11
Chromosomal Location98464902-98546031 bp(-) (GRCm38)
Type of Mutationmissense
DNA Base Change (assembly) A to T at 98490580 bp
ZygosityHeterozygous
Amino Acid Change Methionine to Lysine at position 58 (M58K)
Ref Sequence ENSEMBL: ENSMUSP00000099430 (fasta)
Gene Model predicted gene model for transcript(s): [ENSMUST00000103141]
Predicted Effect probably benign
Transcript: ENSMUST00000103141
AA Change: M58K

PolyPhen 2 Score 0.114 (Sensitivity: 0.93; Specificity: 0.86)
SMART Domains Protein: ENSMUSP00000099430
Gene: ENSMUSG00000018168
AA Change: M58K

DomainStartEndE-ValueType
ZnF_C2H2 117 139 4.34e0 SMART
ZnF_C2H2 145 167 8.02e-5 SMART
ZnF_C2H2 173 195 4.47e-3 SMART
ZnF_C2H2 201 221 7.11e0 SMART
ZnF_C2H2 450 472 7.11e0 SMART
ZnF_C2H2 478 502 1.64e-1 SMART
Predicted Effect noncoding transcript
Transcript: ENSMUST00000140876
Meta Mutation Damage Score 0.0899 question?
Coding Region Coverage
  • 1x: 99.1%
  • 3x: 98.3%
  • 10x: 96.3%
  • 20x: 92.6%
Validation Efficiency 97% (56/58)
MGI Phenotype FUNCTION: [Summary is not available for the mouse gene. This summary is for the human ortholog.] This gene encodes a member of the Ikaros family of zinc-finger proteins. Three members of this protein family (Ikaros, Aiolos and Helios) are hematopoietic-specific transcription factors involved in the regulation of lymphocyte development. This gene product is a transcription factor that is important in the regulation of B lymphocyte proliferation and differentiation. Both Ikaros and Aiolos can participate in chromatin remodeling. Regulation of gene expression in B lymphocytes by Aiolos is complex as it appears to require the sequential formation of Ikaros homodimers, Ikaros/Aiolos heterodimers, and Aiolos homodimers. Several alternative transcripts encoding different isoforms have been described, as well as some non-protein coding variants. [provided by RefSeq, Apr 2012]
PHENOTYPE: Homozygous mutants exhibit greatly reduced B cell populations in the peritoneum, marginal zone and recirculating bone marrow. Aging mutants express autoantibodies, frequently develop B cell lymphomas, and display symptoms characteristic of SLE. [provided by MGI curators]
Allele List at MGI
Other mutations in this stock
Total: 51 list
GeneRefVarChr/LocMutationPredicted EffectZygosity
4930503L19Rik T C 18: 70,458,384 N457S probably damaging Het
Asic4 G A 1: 75,450,923 G31E probably benign Het
Atp2a3 A G 11: 72,975,397 D281G probably damaging Het
Azin1 T C 15: 38,491,551 D387G probably benign Het
Bdp1 T C 13: 100,067,535 M660V probably benign Het
Catsperg2 G A 7: 29,717,066 T307M probably damaging Het
Cfap54 T G 10: 92,815,902 K3095N probably benign Het
Chl1 A G 6: 103,700,543 N706S probably damaging Het
Crym A G 7: 120,199,294 V113A probably benign Het
Cux1 A G 5: 136,312,694 S607P probably damaging Het
Cyp3a44 T C 5: 145,794,397 N198D possibly damaging Het
Dnase1l1 C T X: 74,277,038 probably null Het
Elac1 A G 18: 73,742,669 V97A probably benign Het
Erbb3 G A 10: 128,569,636 T1251M probably damaging Het
Fam198b T A 3: 79,936,603 N12K probably damaging Het
Gprc5c G T 11: 114,864,267 V257L possibly damaging Het
Hydin A G 8: 110,334,784 H316R possibly damaging Het
Lyst T C 13: 13,660,970 Y1746H probably damaging Het
Map3k11 T A 19: 5,700,594 N613K probably benign Het
Mfng C T 15: 78,764,388 R163H probably benign Het
Mrm1 A T 11: 84,819,260 L38Q possibly damaging Het
Myo7b A G 18: 31,998,734 F470L probably damaging Het
Ndst2 G A 14: 20,724,487 R834W probably damaging Het
Olfr1173 T C 2: 88,274,221 Y276C possibly damaging Het
Olfr651 A T 7: 104,553,819 Q300L probably benign Het
Opa1 T A 16: 29,618,130 I637N probably benign Het
Padi4 A G 4: 140,746,131 V665A possibly damaging Het
Pcdh1 A G 18: 38,192,199 Y897H probably damaging Het
Pkp3 A G 7: 141,083,277 D345G probably damaging Het
Pla2g4a T C 1: 149,865,167 M366V possibly damaging Het
Pnkp C T 7: 44,862,403 S113L probably damaging Het
Pon3 T C 6: 5,240,860 D34G possibly damaging Het
Ppargc1b A T 18: 61,315,805 S133T probably damaging Het
Ppp4r3b T C 11: 29,173,309 S2P possibly damaging Het
Rbm20 A G 19: 53,813,387 T109A probably damaging Het
Rexo5 C A 7: 119,844,437 H690Q probably benign Het
Scube2 C T 7: 109,809,230 G670D probably damaging Het
Sipa1l2 T C 8: 125,492,126 I157M probably damaging Het
Slbp A T 5: 33,643,866 I167N probably damaging Het
Sry C G Y: 2,662,975 Q228H unknown Het
Stk36 T C 1: 74,611,158 V283A probably benign Het
Tead1 A G 7: 112,759,466 probably benign Het
Tecpr2 G C 12: 110,915,402 W135S probably damaging Het
Tha1 A C 11: 117,869,676 S241A probably damaging Het
Ttc39a A T 4: 109,422,504 I112F probably benign Het
Vmn1r128 A T 7: 21,349,403 T11S probably benign Het
Vnn1 G A 10: 23,903,405 C404Y probably damaging Het
Wdr41 T C 13: 94,995,251 F57L probably damaging Het
Zfp975 T G 7: 42,662,230 T320P probably damaging Het
Zfp985 A T 4: 147,582,832 probably null Het
Zfpm2 T C 15: 41,099,469 S176P probably benign Het
Other mutations in Ikzf3
AlleleSourceChrCoordTypePredicted EffectPPH Score
IGL01477:Ikzf3 APN 11 98488857 missense probably damaging 1.00
IGL01537:Ikzf3 APN 11 98516892 missense probably damaging 1.00
IGL03376:Ikzf3 APN 11 98488953 missense probably damaging 1.00
R0030:Ikzf3 UTSW 11 98467612 missense probably benign 0.01
R0266:Ikzf3 UTSW 11 98467317 missense probably benign
R1302:Ikzf3 UTSW 11 98516920 missense probably benign
R1464:Ikzf3 UTSW 11 98516905 missense probably benign 0.00
R1464:Ikzf3 UTSW 11 98516905 missense probably benign 0.00
R1500:Ikzf3 UTSW 11 98518695 missense probably benign 0.16
R1531:Ikzf3 UTSW 11 98490446 missense probably damaging 0.98
R1599:Ikzf3 UTSW 11 98467093 missense probably damaging 1.00
R1623:Ikzf3 UTSW 11 98490331 critical splice donor site probably null
R2154:Ikzf3 UTSW 11 98485649 nonsense probably null
R3915:Ikzf3 UTSW 11 98490586 missense probably damaging 1.00
R4004:Ikzf3 UTSW 11 98489017 missense probably damaging 1.00
R4005:Ikzf3 UTSW 11 98489017 missense probably damaging 1.00
R4075:Ikzf3 UTSW 11 98467643 nonsense probably null
R4210:Ikzf3 UTSW 11 98490487 missense probably benign 0.00
R4804:Ikzf3 UTSW 11 98490574 missense probably benign 0.20
R5107:Ikzf3 UTSW 11 98490476 missense probably damaging 1.00
R5267:Ikzf3 UTSW 11 98490580 missense probably benign 0.11
R5450:Ikzf3 UTSW 11 98467086 missense probably damaging 1.00
R6237:Ikzf3 UTSW 11 98467053 missense probably damaging 1.00
R6557:Ikzf3 UTSW 11 98516881 missense probably benign
R7832:Ikzf3 UTSW 11 98518699 missense probably benign
R8058:Ikzf3 UTSW 11 98516927 nonsense probably null
R8073:Ikzf3 UTSW 11 98467429 missense probably benign 0.05
Z1176:Ikzf3 UTSW 11 98467181 missense probably benign 0.01
Predicted Primers PCR Primer
(F):5'- ATGAACCATCAAGACGTTGAAGC -3'
(R):5'- GTGAATGGTCTCCCTCACAG -3'

Sequencing Primer
(F):5'- CGTTGAAGCTAATGCAGGATAACCC -3'
(R):5'- CATTCCGTGAGCTTACTC -3'
Posted On2016-07-06