Mutagenetix > Incidental Mutations

Incidental Mutation 'R5266:Gprc5c'

401717

Institutional Source

Beutler Lab

Gene Symbol

Gprc5c

Ensembl Gene

ENSMUSG00000051043

Gene Name

G protein-coupled receptor, family C, group 5, member C

Synonyms

MMRRC Submission

042858-MU

Accession Numbers

Is this an essential gene?

Possibly non essential (E-score: 0.302) question?

Stock #

R5266 (G1)

Quality Score

222

Status

Validated

Chromosome

Chromosomal Location

114851152-114872617 bp(+) (GRCm38)

Type of Mutation

missense

DNA Base Change (assembly)

G to T at 114864267 bp (GRCm38)

Zygosity

Heterozygous

Amino Acid Change

Valine to Leucine at position 257 (V257L)

Ref Sequence

ENSEMBL: ENSMUSP00000061760 (fasta)

Gene Model

predicted gene model for transcript(s): [ENSMUST00000021071] [ENSMUST00000053361] [ENSMUST00000122967] [ENSMUST00000133245] [ENSMUST00000136785] [ENSMUST00000142262] [ENSMUST00000152314] [ENSMUST00000177952]

AlphaFold

no structure available at present

Predicted Effect

possibly damaging
Transcript: ENSMUST00000021071
AA Change: V257L

PolyPhen 2 Score 0.834 (Sensitivity: 0.84; Specificity: 0.93)

SMART Domains

Protein: ENSMUSP00000021071
Gene: ENSMUSG00000051043
AA Change: V257L

Domain	Start	End	E-Value	Type
signal peptide	1	22	N/A	INTRINSIC
Pfam:7tm_3	58	302	1.3e-42	PFAM

Predicted Effect

possibly damaging
Transcript: ENSMUST00000053361
AA Change: V257L

PolyPhen 2 Score 0.921 (Sensitivity: 0.81; Specificity: 0.94)

SMART Domains

Protein: ENSMUSP00000061760
Gene: ENSMUSG00000051043
AA Change: V257L

Domain	Start	End	E-Value	Type
signal peptide	1	22	N/A	INTRINSIC
Pfam:7tm_3	60	301	1.3e-28	PFAM

Predicted Effect

probably benign
Transcript: ENSMUST00000122967

SMART Domains

Protein: ENSMUSP00000114335
Gene: ENSMUSG00000051043

Domain	Start	End	E-Value	Type
signal peptide	1	22	N/A	INTRINSIC
transmembrane domain	55	77	N/A	INTRINSIC

Predicted Effect

probably benign
Transcript: ENSMUST00000133245

SMART Domains

Protein: ENSMUSP00000121572
Gene: ENSMUSG00000051043

Domain	Start	End	E-Value	Type
signal peptide	1	22	N/A	INTRINSIC
transmembrane domain	55	77	N/A	INTRINSIC

Predicted Effect

possibly damaging
Transcript: ENSMUST00000136785
AA Change: V257L

PolyPhen 2 Score 0.852 (Sensitivity: 0.83; Specificity: 0.93)

SMART Domains

Protein: ENSMUSP00000116786
Gene: ENSMUSG00000051043
AA Change: V257L

Domain	Start	End	E-Value	Type
signal peptide	1	22	N/A	INTRINSIC
Pfam:7tm_3	58	283	1.5e-38	PFAM

Predicted Effect

probably benign
Transcript: ENSMUST00000142262

SMART Domains

Protein: ENSMUSP00000121524
Gene: ENSMUSG00000051043

Domain	Start	End	E-Value	Type
signal peptide	1	22	N/A	INTRINSIC
Pfam:7tm_3	58	133	6.2e-14	PFAM

Predicted Effect

probably benign
Transcript: ENSMUST00000152314

Predicted Effect

possibly damaging
Transcript: ENSMUST00000177952
AA Change: V257L

PolyPhen 2 Score 0.834 (Sensitivity: 0.84; Specificity: 0.93)

SMART Domains

Protein: ENSMUSP00000136702
Gene: ENSMUSG00000051043
AA Change: V257L

Domain	Start	End	E-Value	Type
signal peptide	1	22	N/A	INTRINSIC
Pfam:7tm_3	58	302	1.3e-42	PFAM

Meta Mutation Damage Score

0.1280

Coding Region Coverage

1x: 99.1%
3x: 98.3%
10x: 96.3%
20x: 92.6%

Validation Efficiency

97% (56/58)

MGI Phenotype

FUNCTION: [Summary is not available for the mouse gene. This summary is for the human ortholog.] The protein encoded by this gene is a member of the type 3 G protein-coupled receptor family. Members of this superfamily are characterized by a signature 7-transmembrane domain motif. The specific function of this protein is unknown; however, this protein may mediate the cellular effects of retinoic acid on the G protein signal transduction cascade. Two transcript variants encoding different isoforms have been found for this gene. [provided by RefSeq, Jul 2008]
PHENOTYPE: Mice homozygous for a reporter allele are behaviorally normal but exhibit reticulocytosis, increased mean corpuscular volume, increased percentage of basophils, decreased mean corpuscular hemogloblin concentration, and increased alkaline phophatase and lactic dehydrogenase levels. [provided by MGI curators]

Allele List at MGI

Other mutations in this stock

Total: 51 list
Gene	Ref	Var	Chr/Loc	Mutation	Predicted Effect	Zygosity
4930503L19Rik	T	C	18: 70,458,384	N457S	probably damaging	Het
Asic4	G	A	1: 75,450,923	G31E	probably benign	Het
Atp2a3	A	G	11: 72,975,397	D281G	probably damaging	Het
Azin1	T	C	15: 38,491,551	D387G	probably benign	Het
Bdp1	T	C	13: 100,067,535	M660V	probably benign	Het
Catsperg2	G	A	7: 29,717,066	T307M	probably damaging	Het
Cfap54	T	G	10: 92,815,902	K3095N	probably benign	Het
Chl1	A	G	6: 103,700,543	N706S	probably damaging	Het
Crym	A	G	7: 120,199,294	V113A	probably benign	Het
Cux1	A	G	5: 136,312,694	S607P	probably damaging	Het
Cyp3a44	T	C	5: 145,794,397	N198D	possibly damaging	Het
Dnase1l1	C	T	X: 74,277,038		probably null	Het
Elac1	A	G	18: 73,742,669	V97A	probably benign	Het
Erbb3	G	A	10: 128,569,636	T1251M	probably damaging	Het
Fam198b	T	A	3: 79,936,603	N12K	probably damaging	Het
Hydin	A	G	8: 110,334,784	H316R	possibly damaging	Het
Ikzf3	A	T	11: 98,490,580	M58K	probably benign	Het
Lyst	T	C	13: 13,660,970	Y1746H	probably damaging	Het
Map3k11	T	A	19: 5,700,594	N613K	probably benign	Het
Mfng	C	T	15: 78,764,388	R163H	probably benign	Het
Mrm1	A	T	11: 84,819,260	L38Q	possibly damaging	Het
Myo7b	A	G	18: 31,998,734	F470L	probably damaging	Het
Ndst2	G	A	14: 20,724,487	R834W	probably damaging	Het
Olfr1173	T	C	2: 88,274,221	Y276C	possibly damaging	Het
Olfr651	A	T	7: 104,553,819	Q300L	probably benign	Het
Opa1	T	A	16: 29,618,130	I637N	probably benign	Het
Padi4	A	G	4: 140,746,131	V665A	possibly damaging	Het
Pcdh1	A	G	18: 38,192,199	Y897H	probably damaging	Het
Pkp3	A	G	7: 141,083,277	D345G	probably damaging	Het
Pla2g4a	T	C	1: 149,865,167	M366V	possibly damaging	Het
Pnkp	C	T	7: 44,862,403	S113L	probably damaging	Het
Pon3	T	C	6: 5,240,860	D34G	possibly damaging	Het
Ppargc1b	A	T	18: 61,315,805	S133T	probably damaging	Het
Ppp4r3b	T	C	11: 29,173,309	S2P	possibly damaging	Het
Rbm20	A	G	19: 53,813,387	T109A	probably damaging	Het
Rexo5	C	A	7: 119,844,437	H690Q	probably benign	Het
Scube2	C	T	7: 109,809,230	G670D	probably damaging	Het
Sipa1l2	T	C	8: 125,492,126	I157M	probably damaging	Het
Slbp	A	T	5: 33,643,866	I167N	probably damaging	Het
Sry	C	G	Y: 2,662,975	Q228H	unknown	Het
Stk36	T	C	1: 74,611,158	V283A	probably benign	Het
Tead1	A	G	7: 112,759,466		probably benign	Het
Tecpr2	G	C	12: 110,915,402	W135S	probably damaging	Het
Tha1	A	C	11: 117,869,676	S241A	probably damaging	Het
Ttc39a	A	T	4: 109,422,504	I112F	probably benign	Het
Vmn1r128	A	T	7: 21,349,403	T11S	probably benign	Het
Vnn1	G	A	10: 23,903,405	C404Y	probably damaging	Het
Wdr41	T	C	13: 94,995,251	F57L	probably damaging	Het
Zfp975	T	G	7: 42,662,230	T320P	probably damaging	Het
Zfp985	A	T	4: 147,582,832		probably null	Het
Zfpm2	T	C	15: 41,099,469	S176P	probably benign	Het

Other mutations in Gprc5c

Allele	Source	Chr	Coord	Type	Predicted Effect	PPH Score
IGL01599:Gprc5c	APN	11	114864252	missense	probably benign	0.01
IGL01762:Gprc5c	APN	11	114864024	missense	probably benign	0.28
IGL02039:Gprc5c	APN	11	114864486	nonsense	probably null
R0800:Gprc5c	UTSW	11	114866711	missense	probably damaging	0.99
R1618:Gprc5c	UTSW	11	114864394	missense	possibly damaging	0.88
R4198:Gprc5c	UTSW	11	114863860	missense	probably damaging	1.00
R4807:Gprc5c	UTSW	11	114864498	missense	probably damaging	0.97
R4846:Gprc5c	UTSW	11	114864267	missense	possibly damaging	0.92
R4902:Gprc5c	UTSW	11	114864267	missense	possibly damaging	0.92
R4904:Gprc5c	UTSW	11	114864267	missense	possibly damaging	0.92
R5016:Gprc5c	UTSW	11	114864267	missense	possibly damaging	0.92
R5048:Gprc5c	UTSW	11	114870351	makesense	probably null
R5106:Gprc5c	UTSW	11	114864267	missense	possibly damaging	0.92
R5109:Gprc5c	UTSW	11	114864267	missense	possibly damaging	0.92
R5173:Gprc5c	UTSW	11	114864267	missense	possibly damaging	0.92
R5267:Gprc5c	UTSW	11	114864267	missense	possibly damaging	0.92
R5475:Gprc5c	UTSW	11	114864267	missense	possibly damaging	0.92
R5508:Gprc5c	UTSW	11	114864267	missense	possibly damaging	0.92
R5557:Gprc5c	UTSW	11	114864267	missense	possibly damaging	0.92
R5562:Gprc5c	UTSW	11	114864267	missense	possibly damaging	0.92
R5563:Gprc5c	UTSW	11	114864267	missense	possibly damaging	0.92
R5598:Gprc5c	UTSW	11	114864267	missense	possibly damaging	0.92
R5599:Gprc5c	UTSW	11	114864267	missense	possibly damaging	0.92
R5729:Gprc5c	UTSW	11	114864267	missense	possibly damaging	0.92
R5756:Gprc5c	UTSW	11	114864267	missense	possibly damaging	0.92
R5792:Gprc5c	UTSW	11	114864267	missense	possibly damaging	0.92
R5793:Gprc5c	UTSW	11	114864267	missense	possibly damaging	0.92
R5794:Gprc5c	UTSW	11	114864267	missense	possibly damaging	0.92
R5817:Gprc5c	UTSW	11	114863624	nonsense	probably null
R5976:Gprc5c	UTSW	11	114864487	missense	possibly damaging	0.89
R6151:Gprc5c	UTSW	11	114864025	missense	probably damaging	1.00
R6617:Gprc5c	UTSW	11	114864105	missense	probably benign	0.05
R7108:Gprc5c	UTSW	11	114864282	missense	probably damaging	1.00
R7191:Gprc5c	UTSW	11	114868617	missense	possibly damaging	0.56
R7796:Gprc5c	UTSW	11	114864532	missense	probably damaging	0.97
R8543:Gprc5c	UTSW	11	114864268	missense	probably damaging	1.00

Predicted Primers

PCR Primer
(F):5'- AATGTCAGTGCCGACTCGAC -3'
(R):5'- CTCCTTCAGGATGGTCTCATAG -3'

Sequencing Primer
(F):5'- GACCATGACCTCTCCGTGTG -3'
(R):5'- TCAGGATGGTCTCATAGCCCAC -3'

Posted On

2016-07-06