Mutagenetix > Incidental Mutations

Incidental Mutation 'R5266:Tecpr2'

401719

Institutional Source

Beutler Lab

Gene Symbol

Tecpr2

Ensembl Gene

ENSMUSG00000021275

Gene Name

tectonin beta-propeller repeat containing 2

Synonyms

MMRRC Submission

042858-MU

Accession Numbers

Is this an essential gene?

Non essential (E-score: 0.000) question?

Stock #

R5266 (G1)

Quality Score

225

Status

Validated

Chromosome

Chromosomal Location

110889264-110972394 bp(+) (GRCm38)

Type of Mutation

missense

DNA Base Change (assembly)

G to C at 110915402 bp

Zygosity

Heterozygous

Amino Acid Change

Tryptophan to Serine at position 135 (W135S)

Ref Sequence

ENSEMBL: ENSMUSP00000152826 (fasta)

Gene Model

predicted gene model for transcript(s): [ENSMUST00000165978] [ENSMUST00000169597] [ENSMUST00000223210]

Predicted Effect

probably damaging
Transcript: ENSMUST00000165978
AA Change: W135S

PolyPhen 2 Score 1.000 (Sensitivity: 0.00; Specificity: 1.00)

SMART Domains

Protein: ENSMUSP00000127949
Gene: ENSMUSG00000021275
AA Change: W135S

Domain	Start	End	E-Value	Type
WD40	21	61	8.52e1	SMART
WD40	65	105	2.54e2	SMART
WD40	113	155	2.49e-1	SMART
TECPR	280	314	9.81e0	SMART
TECPR	316	353	2.55e0	SMART
low complexity region	392	424	N/A	INTRINSIC
low complexity region	464	471	N/A	INTRINSIC
low complexity region	553	564	N/A	INTRINSIC
low complexity region	655	670	N/A	INTRINSIC
TECPR	814	850	2.28e2	SMART
TECPR	898	931	1.79e-1	SMART
TECPR	939	974	5.61e-3	SMART
TECPR	985	1023	1.55e-5	SMART
TECPR	1173	1208	1.29e-2	SMART
TECPR	1216	1255	2.82e-8	SMART
TECPR	1266	1308	1.05e-7	SMART
TECPR	1317	1351	1.42e-4	SMART
TECPR	1360	1394	5.03e-5	SMART
low complexity region	1414	1421	N/A	INTRINSIC

Predicted Effect

probably damaging
Transcript: ENSMUST00000169597
AA Change: W135S

PolyPhen 2 Score 1.000 (Sensitivity: 0.00; Specificity: 1.00)

SMART Domains

Protein: ENSMUSP00000126749
Gene: ENSMUSG00000021275
AA Change: W135S

Domain	Start	End	E-Value	Type
WD40	21	61	8.52e1	SMART
WD40	65	105	2.54e2	SMART
WD40	113	155	2.49e-1	SMART
TECPR	280	314	9.81e0	SMART
TECPR	316	353	2.55e0	SMART
low complexity region	392	424	N/A	INTRINSIC
low complexity region	464	471	N/A	INTRINSIC
low complexity region	553	564	N/A	INTRINSIC
low complexity region	655	670	N/A	INTRINSIC
TECPR	814	850	2.28e2	SMART
TECPR	898	931	1.79e-1	SMART
TECPR	939	974	5.61e-3	SMART
TECPR	985	1023	1.55e-5	SMART
TECPR	1173	1208	1.29e-2	SMART
TECPR	1216	1255	2.82e-8	SMART
TECPR	1266	1308	1.05e-7	SMART
TECPR	1317	1351	1.42e-4	SMART
TECPR	1360	1394	5.03e-5	SMART
low complexity region	1414	1421	N/A	INTRINSIC

Predicted Effect

noncoding transcript
Transcript: ENSMUST00000221605

Predicted Effect

probably damaging
Transcript: ENSMUST00000223210
AA Change: W135S

PolyPhen 2 Score 1.000 (Sensitivity: 0.00; Specificity: 1.00)

Predicted Effect

noncoding transcript
Transcript: ENSMUST00000223246

Meta Mutation Damage Score

0.9090

Coding Region Coverage

1x: 99.1%
3x: 98.3%
10x: 96.3%
20x: 92.6%

Validation Efficiency

97% (56/58)

MGI Phenotype

FUNCTION: [Summary is not available for the mouse gene. This summary is for the human ortholog.] The protein encoded by this gene is a member of the tectonin beta-propeller repeat-containing (TECPR) family, and contains both TECPR and tryptophan-aspartic acid repeat (WD repeat) domains. This gene has been implicated in autophagy, as reduced expression levels of this gene have been associated with impaired autophagy. Recessive mutations in this gene have been associated with a hereditary form of spastic paraparesis (HSP). HSP is characterized by progressive spasticity and paralysis of the legs. There is also some evidence linking mutations in this gene with birdshot chorioretinopathy (BSCR), which results in inflammation of the choroid and retina. Alternative splicing results in multiple transcript variants encoding different isoforms. [provided by RefSeq, Aug 2015]

Allele List at MGI

Other mutations in this stock

Total: 51 list
Gene	Ref	Var	Chr/Loc	Mutation	Predicted Effect	Zygosity
4930503L19Rik	T	C	18: 70,458,384	N457S	probably damaging	Het
Asic4	G	A	1: 75,450,923	G31E	probably benign	Het
Atp2a3	A	G	11: 72,975,397	D281G	probably damaging	Het
Azin1	T	C	15: 38,491,551	D387G	probably benign	Het
Bdp1	T	C	13: 100,067,535	M660V	probably benign	Het
Catsperg2	G	A	7: 29,717,066	T307M	probably damaging	Het
Cfap54	T	G	10: 92,815,902	K3095N	probably benign	Het
Chl1	A	G	6: 103,700,543	N706S	probably damaging	Het
Crym	A	G	7: 120,199,294	V113A	probably benign	Het
Cux1	A	G	5: 136,312,694	S607P	probably damaging	Het
Cyp3a44	T	C	5: 145,794,397	N198D	possibly damaging	Het
Dnase1l1	C	T	X: 74,277,038		probably null	Het
Elac1	A	G	18: 73,742,669	V97A	probably benign	Het
Erbb3	G	A	10: 128,569,636	T1251M	probably damaging	Het
Fam198b	T	A	3: 79,936,603	N12K	probably damaging	Het
Gprc5c	G	T	11: 114,864,267	V257L	possibly damaging	Het
Hydin	A	G	8: 110,334,784	H316R	possibly damaging	Het
Ikzf3	A	T	11: 98,490,580	M58K	probably benign	Het
Lyst	T	C	13: 13,660,970	Y1746H	probably damaging	Het
Map3k11	T	A	19: 5,700,594	N613K	probably benign	Het
Mfng	C	T	15: 78,764,388	R163H	probably benign	Het
Mrm1	A	T	11: 84,819,260	L38Q	possibly damaging	Het
Myo7b	A	G	18: 31,998,734	F470L	probably damaging	Het
Ndst2	G	A	14: 20,724,487	R834W	probably damaging	Het
Olfr1173	T	C	2: 88,274,221	Y276C	possibly damaging	Het
Olfr651	A	T	7: 104,553,819	Q300L	probably benign	Het
Opa1	T	A	16: 29,618,130	I637N	probably benign	Het
Padi4	A	G	4: 140,746,131	V665A	possibly damaging	Het
Pcdh1	A	G	18: 38,192,199	Y897H	probably damaging	Het
Pkp3	A	G	7: 141,083,277	D345G	probably damaging	Het
Pla2g4a	T	C	1: 149,865,167	M366V	possibly damaging	Het
Pnkp	C	T	7: 44,862,403	S113L	probably damaging	Het
Pon3	T	C	6: 5,240,860	D34G	possibly damaging	Het
Ppargc1b	A	T	18: 61,315,805	S133T	probably damaging	Het
Ppp4r3b	T	C	11: 29,173,309	S2P	possibly damaging	Het
Rbm20	A	G	19: 53,813,387	T109A	probably damaging	Het
Rexo5	C	A	7: 119,844,437	H690Q	probably benign	Het
Scube2	C	T	7: 109,809,230	G670D	probably damaging	Het
Sipa1l2	T	C	8: 125,492,126	I157M	probably damaging	Het
Slbp	A	T	5: 33,643,866	I167N	probably damaging	Het
Sry	C	G	Y: 2,662,975	Q228H	unknown	Het
Stk36	T	C	1: 74,611,158	V283A	probably benign	Het
Tead1	A	G	7: 112,759,466		probably benign	Het
Tha1	A	C	11: 117,869,676	S241A	probably damaging	Het
Ttc39a	A	T	4: 109,422,504	I112F	probably benign	Het
Vmn1r128	A	T	7: 21,349,403	T11S	probably benign	Het
Vnn1	G	A	10: 23,903,405	C404Y	probably damaging	Het
Wdr41	T	C	13: 94,995,251	F57L	probably damaging	Het
Zfp975	T	G	7: 42,662,230	T320P	probably damaging	Het
Zfp985	A	T	4: 147,582,832		probably null	Het
Zfpm2	T	C	15: 41,099,469	S176P	probably benign	Het

Other mutations in Tecpr2

Allele	Source	Chr	Coord	Type	Predicted Effect	PPH Score
IGL01114:Tecpr2	APN	12	110967779	missense	possibly damaging	0.67
IGL01759:Tecpr2	APN	12	110931392	utr 3 prime	probably benign
IGL02114:Tecpr2	APN	12	110968887	missense	probably damaging	1.00
IGL02813:Tecpr2	APN	12	110933192	missense	probably damaging	1.00
IGL02943:Tecpr2	APN	12	110967749	missense	probably benign
IGL03085:Tecpr2	APN	12	110954826	splice site	probably benign
IGL03290:Tecpr2	APN	12	110967833	missense	possibly damaging	0.65
R0362:Tecpr2	UTSW	12	110968940	missense	probably damaging	0.96
R0486:Tecpr2	UTSW	12	110896369	missense	probably benign	0.01
R0662:Tecpr2	UTSW	12	110896228	missense	probably benign	0.02
R0787:Tecpr2	UTSW	12	110946343	missense	probably benign	0.30
R1147:Tecpr2	UTSW	12	110941438	splice site	probably benign
R1454:Tecpr2	UTSW	12	110968953	missense	probably benign	0.00
R1513:Tecpr2	UTSW	12	110954800	missense	possibly damaging	0.94
R1567:Tecpr2	UTSW	12	110941596	critical splice donor site	probably null
R1569:Tecpr2	UTSW	12	110944887	critical splice donor site	probably null
R1818:Tecpr2	UTSW	12	110926454	missense	probably damaging	1.00
R1856:Tecpr2	UTSW	12	110933064	missense	probably benign
R1897:Tecpr2	UTSW	12	110933247	missense	probably benign
R1903:Tecpr2	UTSW	12	110947912	missense	probably damaging	0.98
R1939:Tecpr2	UTSW	12	110933169	missense	probably damaging	0.98
R1982:Tecpr2	UTSW	12	110954785	missense	probably benign	0.07
R2073:Tecpr2	UTSW	12	110968429	missense	possibly damaging	0.51
R2393:Tecpr2	UTSW	12	110926402	missense	probably damaging	0.99
R2443:Tecpr2	UTSW	12	110896325	missense	probably damaging	1.00
R2484:Tecpr2	UTSW	12	110933318	missense	probably benign
R4564:Tecpr2	UTSW	12	110954785	missense	probably benign	0.07
R4723:Tecpr2	UTSW	12	110932976	missense	probably benign	0.01
R4835:Tecpr2	UTSW	12	110954730	missense	probably benign	0.00
R4847:Tecpr2	UTSW	12	110939877	missense	probably damaging	1.00
R4911:Tecpr2	UTSW	12	110931487	missense	possibly damaging	0.74
R5179:Tecpr2	UTSW	12	110944693	missense	possibly damaging	0.63
R5386:Tecpr2	UTSW	12	110915453	missense	probably damaging	1.00
R5486:Tecpr2	UTSW	12	110933015	missense	probably benign	0.03
R5490:Tecpr2	UTSW	12	110914684	missense	probably damaging	1.00
R5627:Tecpr2	UTSW	12	110941482	missense	probably damaging	0.97
R5836:Tecpr2	UTSW	12	110931511	missense	possibly damaging	0.76
R6052:Tecpr2	UTSW	12	110918891	missense	possibly damaging	0.89
R6084:Tecpr2	UTSW	12	110929109	missense	probably damaging	0.98
R6306:Tecpr2	UTSW	12	110944751	missense	probably damaging	1.00
R6563:Tecpr2	UTSW	12	110929087	missense	probably benign	0.00
R6936:Tecpr2	UTSW	12	110944863	missense	possibly damaging	0.83
R6977:Tecpr2	UTSW	12	110939766	missense	probably benign	0.17
R7110:Tecpr2	UTSW	12	110918972	missense	probably damaging	1.00
R7132:Tecpr2	UTSW	12	110915372	missense	probably damaging	0.97
R7353:Tecpr2	UTSW	12	110967844	missense	probably benign	0.06
R7362:Tecpr2	UTSW	12	110941476	missense	possibly damaging	0.85
R7366:Tecpr2	UTSW	12	110915480	critical splice donor site	probably null
R7404:Tecpr2	UTSW	12	110931604	missense	probably benign	0.00
R7478:Tecpr2	UTSW	12	110968439	missense	probably benign	0.36
R7774:Tecpr2	UTSW	12	110933172	missense	probably benign	0.00
R7922:Tecpr2	UTSW	12	110932642	frame shift	probably null
R7997:Tecpr2	UTSW	12	110933603	missense	probably benign	0.02
R8037:Tecpr2	UTSW	12	110936420	missense	probably benign	0.03
R8038:Tecpr2	UTSW	12	110936420	missense	probably benign	0.03
R8393:Tecpr2	UTSW	12	110944757	missense	probably damaging	0.99
R8411:Tecpr2	UTSW	12	110931720	missense	possibly damaging	0.63
R8726:Tecpr2	UTSW	12	110938234	missense	possibly damaging	0.82
Z1176:Tecpr2	UTSW	12	110896310	missense	probably damaging	0.99

Predicted Primers

PCR Primer
(F):5'- GACATCCTGAGGTTTGGCAGAG -3'
(R):5'- TCAAGGGCACGGTTCTAGAGAG -3'

Sequencing Primer
(F):5'- GCAGAGTGCTGTTGTCCATC -3'
(R):5'- GAACACAGAGGCAAAACTGCTG -3'

Posted On

2016-07-06