Incidental Mutation 'R5266:Ndst2'
ID401722
Institutional Source Beutler Lab
Gene Symbol Ndst2
Ensembl Gene ENSMUSG00000039308
Gene NameN-deacetylase/N-sulfotransferase (heparan glucosaminyl) 2
Synonyms[Heparan sulfate]-glucosamine N-sulfotransferase, glucosaminyl N-deacetylase/N-sulphotransferase-2, Mndns
MMRRC Submission 042858-MU
Accession Numbers
Is this an essential gene? Possibly non essential (E-score: 0.358) question?
Stock #R5266 (G1)
Quality Score225
Status Validated
Chromosome14
Chromosomal Location20723730-20734562 bp(-) (GRCm38)
Type of Mutationmissense
DNA Base Change (assembly) G to A at 20724487 bp
ZygosityHeterozygous
Amino Acid Change Arginine to Tryptophan at position 834 (R834W)
Ref Sequence ENSEMBL: ENSMUSP00000153141 (fasta)
Gene Model predicted gene model for transcript(s): [ENSMUST00000022358] [ENSMUST00000047490] [ENSMUST00000223679] [ENSMUST00000223840] [ENSMUST00000224751] [ENSMUST00000225000] [ENSMUST00000225419]
Predicted Effect probably benign
Transcript: ENSMUST00000022358
SMART Domains Protein: ENSMUSP00000022358
Gene: ENSMUSG00000021819

DomainStartEndE-ValueType
low complexity region 50 66 N/A INTRINSIC
low complexity region 89 102 N/A INTRINSIC
low complexity region 390 405 N/A INTRINSIC
low complexity region 578 612 N/A INTRINSIC
low complexity region 736 751 N/A INTRINSIC
low complexity region 1000 1015 N/A INTRINSIC
low complexity region 1120 1135 N/A INTRINSIC
low complexity region 1176 1211 N/A INTRINSIC
low complexity region 1259 1270 N/A INTRINSIC
low complexity region 1343 1355 N/A INTRINSIC
low complexity region 1470 1487 N/A INTRINSIC
low complexity region 1491 1511 N/A INTRINSIC
low complexity region 1527 1542 N/A INTRINSIC
Predicted Effect probably damaging
Transcript: ENSMUST00000047490
AA Change: R834W

PolyPhen 2 Score 1.000 (Sensitivity: 0.00; Specificity: 1.00)
SMART Domains Protein: ENSMUSP00000040227
Gene: ENSMUSG00000039308
AA Change: R834W

DomainStartEndE-ValueType
Pfam:HSNSD 25 514 9.1e-245 PFAM
Pfam:Sulfotransfer_1 603 866 9.1e-47 PFAM
Predicted Effect noncoding transcript
Transcript: ENSMUST00000223561
Predicted Effect probably damaging
Transcript: ENSMUST00000223679
AA Change: R834W

PolyPhen 2 Score 1.000 (Sensitivity: 0.00; Specificity: 1.00)
Predicted Effect noncoding transcript
Transcript: ENSMUST00000223782
Predicted Effect probably benign
Transcript: ENSMUST00000223840
Predicted Effect noncoding transcript
Transcript: ENSMUST00000224234
Predicted Effect noncoding transcript
Transcript: ENSMUST00000224485
Predicted Effect probably benign
Transcript: ENSMUST00000224751
Predicted Effect silent
Transcript: ENSMUST00000224829
Predicted Effect probably damaging
Transcript: ENSMUST00000225000
AA Change: R834W

PolyPhen 2 Score 1.000 (Sensitivity: 0.00; Specificity: 1.00)
Predicted Effect noncoding transcript
Transcript: ENSMUST00000225010
Predicted Effect noncoding transcript
Transcript: ENSMUST00000225320
Predicted Effect probably benign
Transcript: ENSMUST00000225419
Predicted Effect noncoding transcript
Transcript: ENSMUST00000225187
Predicted Effect probably benign
Transcript: ENSMUST00000225911
Meta Mutation Damage Score 0.9416 question?
Coding Region Coverage
  • 1x: 99.1%
  • 3x: 98.3%
  • 10x: 96.3%
  • 20x: 92.6%
Validation Efficiency 97% (56/58)
MGI Phenotype FUNCTION: [Summary is not available for the mouse gene. This summary is for the human ortholog.] This gene encodes a member of the N-deacetylase/N-sulfotransferase subfamily of the sulfotransferase 1 proteins. The encoded enzyme has dual functions in processing glucosamine and heparin polymers, including N-deacetylation and N-sulfation. The encoded protein may be localized to the Golgi. [provided by RefSeq, Feb 2009]
PHENOTYPE: Mice homozugous for a null allele exhibit reduced mast cell numbers, histamine storage, protease storage and degranulation. [provided by MGI curators]
Allele List at MGI
Other mutations in this stock
Total: 51 list
GeneRefVarChr/LocMutationPredicted EffectZygosity
4930503L19Rik T C 18: 70,458,384 N457S probably damaging Het
Asic4 G A 1: 75,450,923 G31E probably benign Het
Atp2a3 A G 11: 72,975,397 D281G probably damaging Het
Azin1 T C 15: 38,491,551 D387G probably benign Het
Bdp1 T C 13: 100,067,535 M660V probably benign Het
Catsperg2 G A 7: 29,717,066 T307M probably damaging Het
Cfap54 T G 10: 92,815,902 K3095N probably benign Het
Chl1 A G 6: 103,700,543 N706S probably damaging Het
Crym A G 7: 120,199,294 V113A probably benign Het
Cux1 A G 5: 136,312,694 S607P probably damaging Het
Cyp3a44 T C 5: 145,794,397 N198D possibly damaging Het
Dnase1l1 C T X: 74,277,038 probably null Het
Elac1 A G 18: 73,742,669 V97A probably benign Het
Erbb3 G A 10: 128,569,636 T1251M probably damaging Het
Fam198b T A 3: 79,936,603 N12K probably damaging Het
Gprc5c G T 11: 114,864,267 V257L possibly damaging Het
Hydin A G 8: 110,334,784 H316R possibly damaging Het
Ikzf3 A T 11: 98,490,580 M58K probably benign Het
Lyst T C 13: 13,660,970 Y1746H probably damaging Het
Map3k11 T A 19: 5,700,594 N613K probably benign Het
Mfng C T 15: 78,764,388 R163H probably benign Het
Mrm1 A T 11: 84,819,260 L38Q possibly damaging Het
Myo7b A G 18: 31,998,734 F470L probably damaging Het
Olfr1173 T C 2: 88,274,221 Y276C possibly damaging Het
Olfr651 A T 7: 104,553,819 Q300L probably benign Het
Opa1 T A 16: 29,618,130 I637N probably benign Het
Padi4 A G 4: 140,746,131 V665A possibly damaging Het
Pcdh1 A G 18: 38,192,199 Y897H probably damaging Het
Pkp3 A G 7: 141,083,277 D345G probably damaging Het
Pla2g4a T C 1: 149,865,167 M366V possibly damaging Het
Pnkp C T 7: 44,862,403 S113L probably damaging Het
Pon3 T C 6: 5,240,860 D34G possibly damaging Het
Ppargc1b A T 18: 61,315,805 S133T probably damaging Het
Ppp4r3b T C 11: 29,173,309 S2P possibly damaging Het
Rbm20 A G 19: 53,813,387 T109A probably damaging Het
Rexo5 C A 7: 119,844,437 H690Q probably benign Het
Scube2 C T 7: 109,809,230 G670D probably damaging Het
Sipa1l2 T C 8: 125,492,126 I157M probably damaging Het
Slbp A T 5: 33,643,866 I167N probably damaging Het
Sry C G Y: 2,662,975 Q228H unknown Het
Stk36 T C 1: 74,611,158 V283A probably benign Het
Tead1 A G 7: 112,759,466 probably benign Het
Tecpr2 G C 12: 110,915,402 W135S probably damaging Het
Tha1 A C 11: 117,869,676 S241A probably damaging Het
Ttc39a A T 4: 109,422,504 I112F probably benign Het
Vmn1r128 A T 7: 21,349,403 T11S probably benign Het
Vnn1 G A 10: 23,903,405 C404Y probably damaging Het
Wdr41 T C 13: 94,995,251 F57L probably damaging Het
Zfp975 T G 7: 42,662,230 T320P probably damaging Het
Zfp985 A T 4: 147,582,832 probably null Het
Zfpm2 T C 15: 41,099,469 S176P probably benign Het
Other mutations in Ndst2
AlleleSourceChrCoordTypePredicted EffectPPH Score
IGL00576:Ndst2 APN 14 20724484 missense probably benign 0.11
IGL00650:Ndst2 APN 14 20729668 missense possibly damaging 0.77
IGL01565:Ndst2 APN 14 20728206 missense probably damaging 0.98
IGL01746:Ndst2 APN 14 20729414 missense probably benign 0.02
IGL02457:Ndst2 APN 14 20729554 missense possibly damaging 0.95
IGL03193:Ndst2 APN 14 20729849 missense probably damaging 0.97
IGL03238:Ndst2 APN 14 20728504 missense probably damaging 1.00
IGL03277:Ndst2 APN 14 20730166 missense possibly damaging 0.92
R0090:Ndst2 UTSW 14 20727267 missense probably damaging 0.98
R0481:Ndst2 UTSW 14 20724468 missense possibly damaging 0.70
R0677:Ndst2 UTSW 14 20729579 missense probably benign 0.06
R0834:Ndst2 UTSW 14 20729693 missense probably damaging 1.00
R1015:Ndst2 UTSW 14 20730064 missense probably damaging 1.00
R1354:Ndst2 UTSW 14 20724975 missense possibly damaging 0.74
R1678:Ndst2 UTSW 14 20724514 missense probably benign 0.00
R2680:Ndst2 UTSW 14 20724754 missense probably damaging 0.99
R2853:Ndst2 UTSW 14 20729896 missense probably damaging 1.00
R5000:Ndst2 UTSW 14 20724907 critical splice donor site probably null
R6737:Ndst2 UTSW 14 20727494 missense probably damaging 1.00
R7109:Ndst2 UTSW 14 20729843 missense probably damaging 1.00
R7506:Ndst2 UTSW 14 20730085 missense probably benign
R7646:Ndst2 UTSW 14 20724459 critical splice donor site probably null
R7985:Ndst2 UTSW 14 20728410 splice site probably null
R8094:Ndst2 UTSW 14 20728164 missense probably damaging 0.99
Predicted Primers PCR Primer
(F):5'- TTCTTCCCGAAGCCACAAGG -3'
(R):5'- GTTCTGTTTGGAAGAGACATCTC -3'

Sequencing Primer
(F):5'- AGCCGACTCAGCAGCTTTGATAG -3'
(R):5'- AGACATCTCTCCCTGGGCAAG -3'
Posted On2016-07-06