Incidental Mutation 'R5266:Opa1'
ID401726
Institutional Source Beutler Lab
Gene Symbol Opa1
Ensembl Gene ENSMUSG00000038084
Gene NameOPA1, mitochondrial dynamin like GTPase
Synonyms1200011N24Rik, lilr3
MMRRC Submission 042858-MU
Accession Numbers
Is this an essential gene? Essential (E-score: 1.000) question?
Stock #R5266 (G1)
Quality Score225
Status Validated
Chromosome16
Chromosomal Location29579334-29654884 bp(+) (GRCm38)
Type of Mutationmissense
DNA Base Change (assembly) T to A at 29618130 bp
ZygosityHeterozygous
Amino Acid Change Isoleucine to Asparagine at position 637 (I637N)
Ref Sequence ENSEMBL: ENSMUSP00000124739 (fasta)
Gene Model predicted gene model for transcript(s): [ENSMUST00000038867] [ENSMUST00000160475] [ENSMUST00000160597] [ENSMUST00000161186]
Predicted Effect probably benign
Transcript: ENSMUST00000038867
AA Change: I637N

PolyPhen 2 Score 0.012 (Sensitivity: 0.96; Specificity: 0.78)
SMART Domains Protein: ENSMUSP00000036993
Gene: ENSMUSG00000038084
AA Change: I637N

DomainStartEndE-ValueType
low complexity region 63 76 N/A INTRINSIC
low complexity region 91 101 N/A INTRINSIC
low complexity region 189 205 N/A INTRINSIC
coiled coil region 228 271 N/A INTRINSIC
DYNc 283 533 2.18e-10 SMART
coiled coil region 918 967 N/A INTRINSIC
Predicted Effect noncoding transcript
Transcript: ENSMUST00000159036
Predicted Effect noncoding transcript
Transcript: ENSMUST00000160101
Predicted Effect noncoding transcript
Transcript: ENSMUST00000160153
Predicted Effect probably benign
Transcript: ENSMUST00000160475
AA Change: I637N

PolyPhen 2 Score 0.185 (Sensitivity: 0.92; Specificity: 0.87)
SMART Domains Protein: ENSMUSP00000124739
Gene: ENSMUSG00000038084
AA Change: I637N

DomainStartEndE-ValueType
low complexity region 63 76 N/A INTRINSIC
low complexity region 91 101 N/A INTRINSIC
low complexity region 189 205 N/A INTRINSIC
coiled coil region 228 271 N/A INTRINSIC
DYNc 283 533 2.18e-10 SMART
Blast:DYNc 608 632 1e-5 BLAST
Predicted Effect probably benign
Transcript: ENSMUST00000160597
AA Change: I619N

PolyPhen 2 Score 0.012 (Sensitivity: 0.96; Specificity: 0.78)
SMART Domains Protein: ENSMUSP00000124223
Gene: ENSMUSG00000038084
AA Change: I619N

DomainStartEndE-ValueType
low complexity region 63 76 N/A INTRINSIC
low complexity region 91 101 N/A INTRINSIC
coiled coil region 210 253 N/A INTRINSIC
DYNc 265 515 2.18e-10 SMART
coiled coil region 900 949 N/A INTRINSIC
Predicted Effect probably benign
Transcript: ENSMUST00000161186
AA Change: I656N

PolyPhen 2 Score 0.020 (Sensitivity: 0.95; Specificity: 0.80)
SMART Domains Protein: ENSMUSP00000123880
Gene: ENSMUSG00000038084
AA Change: I656N

DomainStartEndE-ValueType
low complexity region 63 76 N/A INTRINSIC
low complexity region 91 101 N/A INTRINSIC
coiled coil region 207 290 N/A INTRINSIC
DYNc 302 552 2.18e-10 SMART
coiled coil region 937 986 N/A INTRINSIC
Meta Mutation Damage Score 0.1479 question?
Coding Region Coverage
  • 1x: 99.1%
  • 3x: 98.3%
  • 10x: 96.3%
  • 20x: 92.6%
Validation Efficiency 97% (56/58)
MGI Phenotype FUNCTION: [Summary is not available for the mouse gene. This summary is for the human ortholog.] This gene product is a nuclear-encoded mitochondrial protein with similarity to dynamin-related GTPases. It is a component of the mitochondrial network. Mutations in this gene have been associated with optic atrophy type 1, which is a dominantly inherited optic neuropathy resulting in progressive loss of visual acuity, leading in many cases to legal blindness. Multiple transcript variants encoding different isoforms have been found for this gene. [provided by RefSeq, Mar 2009]
PHENOTYPE: Mice homozygous for an ENU mutation exhibit embryonic lethality, embryonic growth retardation and morphological abnormalities. Mice heterozygous for an ENU mutation exhibit abnormal cellular morphology, altered optic nerve myelination, abnormal responseto a new environment and decreased vision. [provided by MGI curators]
Allele List at MGI
Other mutations in this stock
Total: 51 list
GeneRefVarChr/LocMutationPredicted EffectZygosity
4930503L19Rik T C 18: 70,458,384 N457S probably damaging Het
Asic4 G A 1: 75,450,923 G31E probably benign Het
Atp2a3 A G 11: 72,975,397 D281G probably damaging Het
Azin1 T C 15: 38,491,551 D387G probably benign Het
Bdp1 T C 13: 100,067,535 M660V probably benign Het
Catsperg2 G A 7: 29,717,066 T307M probably damaging Het
Cfap54 T G 10: 92,815,902 K3095N probably benign Het
Chl1 A G 6: 103,700,543 N706S probably damaging Het
Crym A G 7: 120,199,294 V113A probably benign Het
Cux1 A G 5: 136,312,694 S607P probably damaging Het
Cyp3a44 T C 5: 145,794,397 N198D possibly damaging Het
Dnase1l1 C T X: 74,277,038 probably null Het
Elac1 A G 18: 73,742,669 V97A probably benign Het
Erbb3 G A 10: 128,569,636 T1251M probably damaging Het
Fam198b T A 3: 79,936,603 N12K probably damaging Het
Gprc5c G T 11: 114,864,267 V257L possibly damaging Het
Hydin A G 8: 110,334,784 H316R possibly damaging Het
Ikzf3 A T 11: 98,490,580 M58K probably benign Het
Lyst T C 13: 13,660,970 Y1746H probably damaging Het
Map3k11 T A 19: 5,700,594 N613K probably benign Het
Mfng C T 15: 78,764,388 R163H probably benign Het
Mrm1 A T 11: 84,819,260 L38Q possibly damaging Het
Myo7b A G 18: 31,998,734 F470L probably damaging Het
Ndst2 G A 14: 20,724,487 R834W probably damaging Het
Olfr1173 T C 2: 88,274,221 Y276C possibly damaging Het
Olfr651 A T 7: 104,553,819 Q300L probably benign Het
Padi4 A G 4: 140,746,131 V665A possibly damaging Het
Pcdh1 A G 18: 38,192,199 Y897H probably damaging Het
Pkp3 A G 7: 141,083,277 D345G probably damaging Het
Pla2g4a T C 1: 149,865,167 M366V possibly damaging Het
Pnkp C T 7: 44,862,403 S113L probably damaging Het
Pon3 T C 6: 5,240,860 D34G possibly damaging Het
Ppargc1b A T 18: 61,315,805 S133T probably damaging Het
Ppp4r3b T C 11: 29,173,309 S2P possibly damaging Het
Rbm20 A G 19: 53,813,387 T109A probably damaging Het
Rexo5 C A 7: 119,844,437 H690Q probably benign Het
Scube2 C T 7: 109,809,230 G670D probably damaging Het
Sipa1l2 T C 8: 125,492,126 I157M probably damaging Het
Slbp A T 5: 33,643,866 I167N probably damaging Het
Sry C G Y: 2,662,975 Q228H unknown Het
Stk36 T C 1: 74,611,158 V283A probably benign Het
Tead1 A G 7: 112,759,466 probably benign Het
Tecpr2 G C 12: 110,915,402 W135S probably damaging Het
Tha1 A C 11: 117,869,676 S241A probably damaging Het
Ttc39a A T 4: 109,422,504 I112F probably benign Het
Vmn1r128 A T 7: 21,349,403 T11S probably benign Het
Vnn1 G A 10: 23,903,405 C404Y probably damaging Het
Wdr41 T C 13: 94,995,251 F57L probably damaging Het
Zfp975 T G 7: 42,662,230 T320P probably damaging Het
Zfp985 A T 4: 147,582,832 probably null Het
Zfpm2 T C 15: 41,099,469 S176P probably benign Het
Other mutations in Opa1
AlleleSourceChrCoordTypePredicted EffectPPH Score
IGL01082:Opa1 APN 16 29618115 splice site probably benign
IGL01087:Opa1 APN 16 29586997 missense probably damaging 1.00
IGL01799:Opa1 APN 16 29616658 missense possibly damaging 0.61
IGL01927:Opa1 APN 16 29586995 missense probably benign 0.35
IGL02067:Opa1 APN 16 29616655 missense probably damaging 1.00
IGL02317:Opa1 APN 16 29615166 critical splice donor site probably null
IGL02567:Opa1 APN 16 29588286 missense probably benign 0.01
IGL02826:Opa1 APN 16 29610887 missense probably null
Longshanks UTSW 16 29618259 missense probably damaging 1.00
R0032:Opa1 UTSW 16 29615069 missense probably damaging 1.00
R0032:Opa1 UTSW 16 29615069 missense probably damaging 1.00
R0092:Opa1 UTSW 16 29625594 missense probably damaging 0.99
R0114:Opa1 UTSW 16 29629635 missense probably benign 0.35
R0200:Opa1 UTSW 16 29614129 missense probably benign 0.08
R0308:Opa1 UTSW 16 29621531 missense probably damaging 0.98
R0427:Opa1 UTSW 16 29611461 missense probably damaging 0.98
R0671:Opa1 UTSW 16 29602207 splice site probably benign
R1768:Opa1 UTSW 16 29620810 missense probably benign
R1889:Opa1 UTSW 16 29625585 missense possibly damaging 0.67
R3932:Opa1 UTSW 16 29610880 missense probably damaging 1.00
R3933:Opa1 UTSW 16 29610880 missense probably damaging 1.00
R4434:Opa1 UTSW 16 29611983 missense probably damaging 1.00
R4618:Opa1 UTSW 16 29587039 missense probably damaging 1.00
R4926:Opa1 UTSW 16 29648973 missense possibly damaging 0.94
R5163:Opa1 UTSW 16 29597620 missense probably damaging 0.99
R5249:Opa1 UTSW 16 29618259 missense probably damaging 1.00
R5275:Opa1 UTSW 16 29611579 missense probably damaging 1.00
R5372:Opa1 UTSW 16 29586119 missense probably benign 0.00
R5990:Opa1 UTSW 16 29587018 missense probably damaging 0.99
R6054:Opa1 UTSW 16 29615134 missense probably damaging 1.00
R6483:Opa1 UTSW 16 29628707 missense possibly damaging 0.72
R6522:Opa1 UTSW 16 29625514 missense probably benign 0.06
R6889:Opa1 UTSW 16 29620868 missense probably benign 0.22
R7225:Opa1 UTSW 16 29614039 splice site probably null
R7243:Opa1 UTSW 16 29586996 missense probably benign 0.01
R7324:Opa1 UTSW 16 29586981 missense probably benign
R7831:Opa1 UTSW 16 29648937 missense probably benign 0.02
R8304:Opa1 UTSW 16 29597671 missense possibly damaging 0.80
R8317:Opa1 UTSW 16 29614144 missense probably damaging 1.00
R8353:Opa1 UTSW 16 29620868 missense probably damaging 0.99
R8453:Opa1 UTSW 16 29620868 missense probably damaging 0.99
R8795:Opa1 UTSW 16 29629632 missense probably damaging 1.00
RF012:Opa1 UTSW 16 29613966 missense probably damaging 1.00
T0722:Opa1 UTSW 16 29610930 critical splice donor site probably null
X0065:Opa1 UTSW 16 29620784 missense possibly damaging 0.67
Predicted Primers PCR Primer
(F):5'- CATGCCTCGGTTATCTTCTAATAAGC -3'
(R):5'- ACATTATATCCTAACCTCGACTGC -3'

Sequencing Primer
(F):5'- TCGGTTATCTTCTAATAAGCCTGTAG -3'
(R):5'- ACCTCGACTGCTTTATTAGGAAG -3'
Posted On2016-07-06