Mutagenetix > Incidental Mutations

Incidental Mutation 'R5266:Ppargc1b'

401730

Institutional Source

Beutler Lab

Gene Symbol

Ppargc1b

Ensembl Gene

ENSMUSG00000033871

Gene Name

peroxisome proliferative activated receptor, gamma, coactivator 1 beta

Synonyms

PGC-1beta/ERRL1, 4631412G21Rik

MMRRC Submission

042858-MU

Accession Numbers

Is this an essential gene?

Possibly non essential (E-score: 0.279) question?

Stock #

R5266 (G1)

Quality Score

177

Status

Validated

Chromosome

Chromosomal Location

61298136-61400431 bp(-) (GRCm38)

Type of Mutation

missense

DNA Base Change (assembly)

A to T at 61315805 bp

Zygosity

Heterozygous

Amino Acid Change

Serine to Threonine at position 133 (S133T)

Ref Sequence

ENSEMBL: ENSMUSP00000074771 (fasta)

Gene Model

predicted gene model for transcript(s): [ENSMUST00000063307] [ENSMUST00000075299]

Predicted Effect

probably damaging
Transcript: ENSMUST00000063307
AA Change: S149T

PolyPhen 2 Score 0.999 (Sensitivity: 0.14; Specificity: 0.99)

SMART Domains

Protein: ENSMUSP00000069431
Gene: ENSMUSG00000033871
AA Change: S149T

Domain	Start	End	E-Value	Type
low complexity region	3	17	N/A	INTRINSIC
low complexity region	107	112	N/A	INTRINSIC
low complexity region	137	156	N/A	INTRINSIC
low complexity region	169	189	N/A	INTRINSIC
coiled coil region	437	472	N/A	INTRINSIC
low complexity region	613	619	N/A	INTRINSIC
low complexity region	640	656	N/A	INTRINSIC
low complexity region	799	833	N/A	INTRINSIC
low complexity region	852	872	N/A	INTRINSIC
RRM	910	980	8.87e-7	SMART

Predicted Effect

probably damaging
Transcript: ENSMUST00000075299
AA Change: S133T

PolyPhen 2 Score 0.999 (Sensitivity: 0.14; Specificity: 0.99)

SMART Domains

Protein: ENSMUSP00000074771
Gene: ENSMUSG00000033871
AA Change: S133T

Domain	Start	End	E-Value	Type
low complexity region	91	96	N/A	INTRINSIC
low complexity region	121	140	N/A	INTRINSIC
low complexity region	153	173	N/A	INTRINSIC
coiled coil region	421	456	N/A	INTRINSIC
low complexity region	597	603	N/A	INTRINSIC
low complexity region	624	640	N/A	INTRINSIC
low complexity region	783	817	N/A	INTRINSIC
low complexity region	836	856	N/A	INTRINSIC
RRM	894	964	8.87e-7	SMART

Meta Mutation Damage Score

0.1078

Coding Region Coverage

1x: 99.1%
3x: 98.3%
10x: 96.3%
20x: 92.6%

Validation Efficiency

97% (56/58)

MGI Phenotype

FUNCTION: [Summary is not available for the mouse gene. This summary is for the human ortholog.] The protein encoded by this gene stimulates the activity of several transcription factors and nuclear receptors, including estrogen receptor alpha, nuclear respiratory factor 1, and glucocorticoid receptor. The encoded protein may be involved in fat oxidation, non-oxidative glucose metabolism, and the regulation of energy expenditure. This protein is downregulated in prediabetic and type 2 diabetes mellitus patients. Certain allelic variations in this gene increase the risk of the development of obesity. Three transcript variants encoding different isoforms have been found for this gene. [provided by RefSeq, Mar 2010]
PHENOTYPE: Homozygous inactivation of this gene can lead to postnatal lethality and impaired mitochondrial activity, adaptive thermogenesis, and hepatic function. Homozygotes for a null allele also display a defect in heart rate regulation, reduced body weight and WAT content, and increased energy expenditure. [provided by MGI curators]

Allele List at MGI

Other mutations in this stock

Total: 51 list
Gene	Ref	Var	Chr/Loc	Mutation	Predicted Effect	Zygosity
4930503L19Rik	T	C	18: 70,458,384	N457S	probably damaging	Het
Asic4	G	A	1: 75,450,923	G31E	probably benign	Het
Atp2a3	A	G	11: 72,975,397	D281G	probably damaging	Het
Azin1	T	C	15: 38,491,551	D387G	probably benign	Het
Bdp1	T	C	13: 100,067,535	M660V	probably benign	Het
Catsperg2	G	A	7: 29,717,066	T307M	probably damaging	Het
Cfap54	T	G	10: 92,815,902	K3095N	probably benign	Het
Chl1	A	G	6: 103,700,543	N706S	probably damaging	Het
Crym	A	G	7: 120,199,294	V113A	probably benign	Het
Cux1	A	G	5: 136,312,694	S607P	probably damaging	Het
Cyp3a44	T	C	5: 145,794,397	N198D	possibly damaging	Het
Dnase1l1	C	T	X: 74,277,038		probably null	Het
Elac1	A	G	18: 73,742,669	V97A	probably benign	Het
Erbb3	G	A	10: 128,569,636	T1251M	probably damaging	Het
Fam198b	T	A	3: 79,936,603	N12K	probably damaging	Het
Gprc5c	G	T	11: 114,864,267	V257L	possibly damaging	Het
Hydin	A	G	8: 110,334,784	H316R	possibly damaging	Het
Ikzf3	A	T	11: 98,490,580	M58K	probably benign	Het
Lyst	T	C	13: 13,660,970	Y1746H	probably damaging	Het
Map3k11	T	A	19: 5,700,594	N613K	probably benign	Het
Mfng	C	T	15: 78,764,388	R163H	probably benign	Het
Mrm1	A	T	11: 84,819,260	L38Q	possibly damaging	Het
Myo7b	A	G	18: 31,998,734	F470L	probably damaging	Het
Ndst2	G	A	14: 20,724,487	R834W	probably damaging	Het
Olfr1173	T	C	2: 88,274,221	Y276C	possibly damaging	Het
Olfr651	A	T	7: 104,553,819	Q300L	probably benign	Het
Opa1	T	A	16: 29,618,130	I637N	probably benign	Het
Padi4	A	G	4: 140,746,131	V665A	possibly damaging	Het
Pcdh1	A	G	18: 38,192,199	Y897H	probably damaging	Het
Pkp3	A	G	7: 141,083,277	D345G	probably damaging	Het
Pla2g4a	T	C	1: 149,865,167	M366V	possibly damaging	Het
Pnkp	C	T	7: 44,862,403	S113L	probably damaging	Het
Pon3	T	C	6: 5,240,860	D34G	possibly damaging	Het
Ppp4r3b	T	C	11: 29,173,309	S2P	possibly damaging	Het
Rbm20	A	G	19: 53,813,387	T109A	probably damaging	Het
Rexo5	C	A	7: 119,844,437	H690Q	probably benign	Het
Scube2	C	T	7: 109,809,230	G670D	probably damaging	Het
Sipa1l2	T	C	8: 125,492,126	I157M	probably damaging	Het
Slbp	A	T	5: 33,643,866	I167N	probably damaging	Het
Sry	C	G	Y: 2,662,975	Q228H	unknown	Het
Stk36	T	C	1: 74,611,158	V283A	probably benign	Het
Tead1	A	G	7: 112,759,466		probably benign	Het
Tecpr2	G	C	12: 110,915,402	W135S	probably damaging	Het
Tha1	A	C	11: 117,869,676	S241A	probably damaging	Het
Ttc39a	A	T	4: 109,422,504	I112F	probably benign	Het
Vmn1r128	A	T	7: 21,349,403	T11S	probably benign	Het
Vnn1	G	A	10: 23,903,405	C404Y	probably damaging	Het
Wdr41	T	C	13: 94,995,251	F57L	probably damaging	Het
Zfp975	T	G	7: 42,662,230	T320P	probably damaging	Het
Zfp985	A	T	4: 147,582,832		probably null	Het
Zfpm2	T	C	15: 41,099,469	S176P	probably benign	Het

Other mutations in Ppargc1b

Allele	Source	Chr	Coord	Type	Predicted Effect	PPH Score
IGL00965:Ppargc1b	APN	18	61323164	missense	probably damaging	1.00
IGL02160:Ppargc1b	APN	18	61310435	missense	probably damaging	1.00
IGL02176:Ppargc1b	APN	18	61310875	nonsense	probably null
IGL02176:Ppargc1b	APN	18	61310874	missense	probably damaging	1.00
IGL02183:Ppargc1b	APN	18	61309096	critical splice acceptor site	probably null
IGL02386:Ppargc1b	APN	18	61323151	missense	probably damaging	1.00
IGL02620:Ppargc1b	APN	18	61298739	missense	probably damaging	1.00
IGL02688:Ppargc1b	APN	18	61312243	missense	possibly damaging	0.94
IGL02801:Ppargc1b	APN	18	61307684	missense	possibly damaging	0.77
IGL02970:Ppargc1b	APN	18	61298766	missense	probably damaging	1.00
R0033:Ppargc1b	UTSW	18	61307694	missense	probably damaging	1.00
R0139:Ppargc1b	UTSW	18	61315963	splice site	probably benign
R0194:Ppargc1b	UTSW	18	61307945	missense	possibly damaging	0.94
R0412:Ppargc1b	UTSW	18	61315861	missense	probably damaging	0.99
R0574:Ppargc1b	UTSW	18	61302739	missense	probably benign	0.34
R0576:Ppargc1b	UTSW	18	61311441	missense	probably damaging	0.98
R1546:Ppargc1b	UTSW	18	61310606	missense	probably damaging	1.00
R1721:Ppargc1b	UTSW	18	61307204	splice site	probably null
R1758:Ppargc1b	UTSW	18	61298786	splice site	probably null
R1951:Ppargc1b	UTSW	18	61298777	missense	possibly damaging	0.55
R2110:Ppargc1b	UTSW	18	61311250	missense	probably benign	0.00
R2112:Ppargc1b	UTSW	18	61311250	missense	probably benign	0.00
R2212:Ppargc1b	UTSW	18	61311220	nonsense	probably null
R2432:Ppargc1b	UTSW	18	61307799	missense	possibly damaging	0.93
R3612:Ppargc1b	UTSW	18	61310556	missense	probably benign	0.07
R3848:Ppargc1b	UTSW	18	61311042	missense	probably damaging	1.00
R3913:Ppargc1b	UTSW	18	61311376	missense	probably damaging	0.99
R4328:Ppargc1b	UTSW	18	61382469	nonsense	probably null
R4502:Ppargc1b	UTSW	18	61302679	missense	probably benign	0.39
R4762:Ppargc1b	UTSW	18	61311257	missense	possibly damaging	0.93
R5032:Ppargc1b	UTSW	18	61307265	missense	probably damaging	1.00
R5111:Ppargc1b	UTSW	18	61310487	missense	probably damaging	1.00
R5119:Ppargc1b	UTSW	18	61307654	missense	probably benign	0.38
R5164:Ppargc1b	UTSW	18	61302644	missense	probably damaging	1.00
R5350:Ppargc1b	UTSW	18	61309063	missense	possibly damaging	0.78
R5478:Ppargc1b	UTSW	18	61307568	missense	probably benign
R5719:Ppargc1b	UTSW	18	61307568	missense	probably benign
R5876:Ppargc1b	UTSW	18	61309093	missense	probably damaging	0.99
R5877:Ppargc1b	UTSW	18	61309093	missense	probably damaging	0.99
R5879:Ppargc1b	UTSW	18	61309093	missense	probably damaging	0.99
R5967:Ppargc1b	UTSW	18	61298766	missense	probably damaging	1.00
R6030:Ppargc1b	UTSW	18	61307934	nonsense	probably null
R6030:Ppargc1b	UTSW	18	61307934	nonsense	probably null
R6135:Ppargc1b	UTSW	18	61315909	missense	probably damaging	0.99
R6533:Ppargc1b	UTSW	18	61307774	missense	possibly damaging	0.93
R6791:Ppargc1b	UTSW	18	61307676	missense	probably damaging	1.00
R6792:Ppargc1b	UTSW	18	61307676	missense	probably damaging	1.00
R7033:Ppargc1b	UTSW	18	61307714	missense	probably damaging	0.96
R7316:Ppargc1b	UTSW	18	61307838	missense	probably damaging	0.97
R7560:Ppargc1b	UTSW	18	61312210	missense	probably damaging	1.00
R8007:Ppargc1b	UTSW	18	61310494	missense	possibly damaging	0.55
R8374:Ppargc1b	UTSW	18	61310493	missense	probably damaging	0.99

Predicted Primers

PCR Primer
(F):5'- GGAAATCTCACACCTCAGGG -3'
(R):5'- CGGATTTCTTAGGCTCAGGG -3'

Sequencing Primer
(F):5'- TCACACCTCAGGGCCTGATG -3'
(R):5'- TTCATCGGGGTAGGCAGC -3'

Posted On

2016-07-06