Incidental Mutation 'R5266:4930503L19Rik'
ID401731
Institutional Source Beutler Lab
Gene Symbol 4930503L19Rik
Ensembl Gene ENSMUSG00000044906
Gene NameRIKEN cDNA 4930503L19 gene
SynonymsLas2
MMRRC Submission 042858-MU
Accession Numbers
Is this an essential gene? Probably non essential (E-score: 0.080) question?
Stock #R5266 (G1)
Quality Score225
Status Validated
Chromosome18
Chromosomal Location70452212-70472509 bp(-) (GRCm38)
Type of Mutationmissense
DNA Base Change (assembly) T to C at 70458384 bp
ZygosityHeterozygous
Amino Acid Change Asparagine to Serine at position 457 (N457S)
Ref Sequence ENSEMBL: ENSMUSP00000065118 (fasta)
Gene Model predicted gene model for transcript(s): [ENSMUST00000067556] [ENSMUST00000211817] [ENSMUST00000212074] [ENSMUST00000212155] [ENSMUST00000212539] [ENSMUST00000212683] [ENSMUST00000212982]
Predicted Effect probably damaging
Transcript: ENSMUST00000067556
AA Change: N457S

PolyPhen 2 Score 0.998 (Sensitivity: 0.27; Specificity: 0.99)
SMART Domains Protein: ENSMUSP00000065118
Gene: ENSMUSG00000044906
AA Change: N457S

DomainStartEndE-ValueType
low complexity region 15 40 N/A INTRINSIC
Pfam:LAS2 161 235 2.8e-26 PFAM
Pfam:LAS2 325 387 9.2e-17 PFAM
Predicted Effect probably benign
Transcript: ENSMUST00000211817
AA Change: N189S

PolyPhen 2 Score 0.424 (Sensitivity: 0.89; Specificity: 0.90)
Predicted Effect possibly damaging
Transcript: ENSMUST00000212074
AA Change: N288S

PolyPhen 2 Score 0.659 (Sensitivity: 0.86; Specificity: 0.91)
Predicted Effect probably benign
Transcript: ENSMUST00000212155
Predicted Effect probably benign
Transcript: ENSMUST00000212539
Predicted Effect probably benign
Transcript: ENSMUST00000212683
Predicted Effect probably benign
Transcript: ENSMUST00000212982
Predicted Effect noncoding transcript
Transcript: ENSMUST00000213066
Meta Mutation Damage Score 0.0602 question?
Coding Region Coverage
  • 1x: 99.1%
  • 3x: 98.3%
  • 10x: 96.3%
  • 20x: 92.6%
Validation Efficiency 97% (56/58)
Allele List at MGI
Other mutations in this stock
Total: 51 list
GeneRefVarChr/LocMutationPredicted EffectZygosity
Asic4 G A 1: 75,450,923 G31E probably benign Het
Atp2a3 A G 11: 72,975,397 D281G probably damaging Het
Azin1 T C 15: 38,491,551 D387G probably benign Het
Bdp1 T C 13: 100,067,535 M660V probably benign Het
Catsperg2 G A 7: 29,717,066 T307M probably damaging Het
Cfap54 T G 10: 92,815,902 K3095N probably benign Het
Chl1 A G 6: 103,700,543 N706S probably damaging Het
Crym A G 7: 120,199,294 V113A probably benign Het
Cux1 A G 5: 136,312,694 S607P probably damaging Het
Cyp3a44 T C 5: 145,794,397 N198D possibly damaging Het
Dnase1l1 C T X: 74,277,038 probably null Het
Elac1 A G 18: 73,742,669 V97A probably benign Het
Erbb3 G A 10: 128,569,636 T1251M probably damaging Het
Fam198b T A 3: 79,936,603 N12K probably damaging Het
Gprc5c G T 11: 114,864,267 V257L possibly damaging Het
Hydin A G 8: 110,334,784 H316R possibly damaging Het
Ikzf3 A T 11: 98,490,580 M58K probably benign Het
Lyst T C 13: 13,660,970 Y1746H probably damaging Het
Map3k11 T A 19: 5,700,594 N613K probably benign Het
Mfng C T 15: 78,764,388 R163H probably benign Het
Mrm1 A T 11: 84,819,260 L38Q possibly damaging Het
Myo7b A G 18: 31,998,734 F470L probably damaging Het
Ndst2 G A 14: 20,724,487 R834W probably damaging Het
Olfr1173 T C 2: 88,274,221 Y276C possibly damaging Het
Olfr651 A T 7: 104,553,819 Q300L probably benign Het
Opa1 T A 16: 29,618,130 I637N probably benign Het
Padi4 A G 4: 140,746,131 V665A possibly damaging Het
Pcdh1 A G 18: 38,192,199 Y897H probably damaging Het
Pkp3 A G 7: 141,083,277 D345G probably damaging Het
Pla2g4a T C 1: 149,865,167 M366V possibly damaging Het
Pnkp C T 7: 44,862,403 S113L probably damaging Het
Pon3 T C 6: 5,240,860 D34G possibly damaging Het
Ppargc1b A T 18: 61,315,805 S133T probably damaging Het
Ppp4r3b T C 11: 29,173,309 S2P possibly damaging Het
Rbm20 A G 19: 53,813,387 T109A probably damaging Het
Rexo5 C A 7: 119,844,437 H690Q probably benign Het
Scube2 C T 7: 109,809,230 G670D probably damaging Het
Sipa1l2 T C 8: 125,492,126 I157M probably damaging Het
Slbp A T 5: 33,643,866 I167N probably damaging Het
Sry C G Y: 2,662,975 Q228H unknown Het
Stk36 T C 1: 74,611,158 V283A probably benign Het
Tead1 A G 7: 112,759,466 probably benign Het
Tecpr2 G C 12: 110,915,402 W135S probably damaging Het
Tha1 A C 11: 117,869,676 S241A probably damaging Het
Ttc39a A T 4: 109,422,504 I112F probably benign Het
Vmn1r128 A T 7: 21,349,403 T11S probably benign Het
Vnn1 G A 10: 23,903,405 C404Y probably damaging Het
Wdr41 T C 13: 94,995,251 F57L probably damaging Het
Zfp975 T G 7: 42,662,230 T320P probably damaging Het
Zfp985 A T 4: 147,582,832 probably null Het
Zfpm2 T C 15: 41,099,469 S176P probably benign Het
Other mutations in 4930503L19Rik
AlleleSourceChrCoordTypePredicted EffectPPH Score
IGL00981:4930503L19Rik APN 18 70453333 nonsense probably null
IGL01549:4930503L19Rik APN 18 70468035 missense possibly damaging 0.46
R0119:4930503L19Rik UTSW 18 70469482 nonsense probably null
R0299:4930503L19Rik UTSW 18 70469482 nonsense probably null
R0554:4930503L19Rik UTSW 18 70467380 missense probably damaging 1.00
R0657:4930503L19Rik UTSW 18 70469482 nonsense probably null
R0973:4930503L19Rik UTSW 18 70467926 unclassified probably null
R0973:4930503L19Rik UTSW 18 70467926 unclassified probably null
R0974:4930503L19Rik UTSW 18 70467926 unclassified probably null
R1710:4930503L19Rik UTSW 18 70468063 missense possibly damaging 0.83
R2046:4930503L19Rik UTSW 18 70467482 missense probably damaging 1.00
R2361:4930503L19Rik UTSW 18 70469575 missense probably damaging 1.00
R2936:4930503L19Rik UTSW 18 70468448 missense probably damaging 0.98
R6317:4930503L19Rik UTSW 18 70468193 missense probably damaging 1.00
R6381:4930503L19Rik UTSW 18 70467717 missense probably damaging 1.00
R7108:4930503L19Rik UTSW 18 70468476 missense probably benign 0.30
Predicted Primers PCR Primer
(F):5'- ATTCTACTCCCAGACAACACTGC -3'
(R):5'- ATACATTGTTGTCTTGACTTTTGCA -3'

Sequencing Primer
(F):5'- TATGGCTGAAACCTGTGAAACC -3'
(R):5'- AACTTTAGAGCTCTACTCTATC -3'
Posted On2016-07-06