Incidental Mutation 'R5267:Il20ra'
ID 401784
Institutional Source Beutler Lab
Gene Symbol Il20ra
Ensembl Gene ENSMUSG00000020007
Gene Name interleukin 20 receptor, alpha
Synonyms
MMRRC Submission 042859-MU
Accession Numbers
Essential gene? Non essential (E-score: 0.000) question?
Stock # R5267 (G1)
Quality Score 183
Status Validated
Chromosome 10
Chromosomal Location 19588318-19635801 bp(+) (GRCm39)
Type of Mutation missense
DNA Base Change (assembly) A to G at 19625107 bp (GRCm39)
Zygosity Heterozygous
Amino Acid Change Threonine to Alanine at position 129 (T129A)
Ref Sequence ENSEMBL: ENSMUSP00000020185 (fasta)
Gene Model predicted gene model for transcript(s): [ENSMUST00000020185] [ENSMUST00000217389]
AlphaFold Q6PHB0
Predicted Effect probably damaging
Transcript: ENSMUST00000020185
AA Change: T129A

PolyPhen 2 Score 0.990 (Sensitivity: 0.72; Specificity: 0.97)
SMART Domains Protein: ENSMUSP00000020185
Gene: ENSMUSG00000020007
AA Change: T129A

DomainStartEndE-ValueType
Pfam:Tissue_fac 16 126 1.8e-33 PFAM
Pfam:Interfer-bind 138 243 4.6e-23 PFAM
transmembrane domain 255 277 N/A INTRINSIC
Predicted Effect probably benign
Transcript: ENSMUST00000217389
Meta Mutation Damage Score 0.6467 question?
Coding Region Coverage
  • 1x: 99.1%
  • 3x: 98.4%
  • 10x: 96.7%
  • 20x: 93.8%
Validation Efficiency 98% (86/88)
MGI Phenotype FUNCTION: [Summary is not available for the mouse gene. This summary is for the human ortholog.] This gene encodes a member of the type II cytokine receptor family. The encoded protein is a subunit of the receptor for interleukin 20, a cytokine that may be involved in epidermal function. The interleukin 20 receptor is a heterodimeric complex consisting of the encoded protein and interleukin 20 receptor beta. This gene and interleukin 20 receptor beta are highly expressed in skin, and are upregulated in psoriasis. Alternative splicing results in multiple transcript variants. [provided by RefSeq, Jul 2013]
PHENOTYPE: Mice homozygous for a knock-out allele exhibit increased bone mineral density, impaired osteoclast differentiation, and resistance to ovariectomized-inducced bone loss. [provided by MGI curators]
Allele List at MGI

All alleles(4) : Targeted(4)

Other mutations in this stock
Total: 79 list
GeneRefVarChr/LocMutationPredicted EffectZygosity
Abca12 T A 1: 71,374,933 (GRCm39) probably benign Het
Adam15 T G 3: 89,257,206 (GRCm39) probably benign Het
Albfm1 T C 5: 90,732,716 (GRCm39) F509S probably damaging Het
Atp12a T C 14: 56,621,668 (GRCm39) S768P probably damaging Het
Atp8a1 G A 5: 67,919,887 (GRCm39) T393I probably damaging Het
B4galnt4 T G 7: 140,650,524 (GRCm39) I3S probably damaging Het
Bfsp1 G A 2: 143,668,971 (GRCm39) T536I probably benign Het
Brsk1 G T 7: 4,707,708 (GRCm39) W284L probably damaging Het
Cadm3 A T 1: 173,164,669 (GRCm39) D370E probably damaging Het
Cadps2 A G 6: 23,626,667 (GRCm39) I207T possibly damaging Het
Calr4 A C 4: 109,101,273 (GRCm39) T52P probably damaging Het
Catsperg2 G A 7: 29,416,491 (GRCm39) T307M probably damaging Het
Ckap5 T A 2: 91,422,097 (GRCm39) N1166K probably null Het
Clca4a G A 3: 144,659,573 (GRCm39) T761I probably damaging Het
Cnksr3 A T 10: 7,076,633 (GRCm39) probably null Het
Diaph3 A G 14: 86,893,989 (GRCm39) S7P probably benign Het
Dnah7a G A 1: 53,518,851 (GRCm39) P2969S probably damaging Het
Dnai2 A T 11: 114,631,293 (GRCm39) T221S probably benign Het
Dsc2 A G 18: 20,167,640 (GRCm39) probably null Het
Eif4g1 A G 16: 20,504,283 (GRCm39) N789S probably damaging Het
Fn1 C T 1: 71,668,863 (GRCm39) R694H probably damaging Het
Gm5478 G A 15: 101,552,837 (GRCm39) R365C probably damaging Het
Gm5591 A T 7: 38,218,338 (GRCm39) M845K possibly damaging Het
Gm5800 A T 14: 51,951,294 (GRCm39) probably null Het
Gprc5c G T 11: 114,755,093 (GRCm39) V257L possibly damaging Het
H2-Q2 A T 17: 35,562,155 (GRCm39) Y134F probably benign Het
Hcfc1r1 A G 17: 23,893,648 (GRCm39) R76G possibly damaging Het
Hectd4 T C 5: 121,482,887 (GRCm39) I3146T probably benign Het
Herc1 G T 9: 66,369,091 (GRCm39) L2928F probably damaging Het
Hmx3 C T 7: 131,145,898 (GRCm39) A202V probably benign Het
Ikzf3 A T 11: 98,381,406 (GRCm39) M58K probably benign Het
Il21 T C 3: 37,281,946 (GRCm39) H66R probably benign Het
Kcnh5 A T 12: 75,134,190 (GRCm39) M453K probably damaging Het
Kdf1 C G 4: 133,256,258 (GRCm39) A325G probably damaging Het
Klhl10 C T 11: 100,338,047 (GRCm39) A262V probably benign Het
Krt81 T A 15: 101,357,340 (GRCm39) N464I probably benign Het
Ksr1 A T 11: 78,911,251 (GRCm39) I698N probably damaging Het
Lrp2 A G 2: 69,379,322 (GRCm39) V130A possibly damaging Het
Mcm2 T C 6: 88,874,432 (GRCm39) T25A probably benign Het
Mrps18c T A 5: 100,950,960 (GRCm39) Y93* probably null Het
Mycl C T 4: 122,894,289 (GRCm39) A363V probably damaging Het
Mylk2 C A 2: 152,755,469 (GRCm39) A211E probably benign Het
Myo5a G A 9: 75,059,292 (GRCm39) D507N probably damaging Het
Myo7b A G 18: 32,131,787 (GRCm39) F470L probably damaging Het
Oas1a A T 5: 121,037,284 (GRCm39) C248S probably benign Het
Or2ag2b T C 7: 106,418,015 (GRCm39) S242P probably damaging Het
Or4c15b C T 2: 89,112,574 (GRCm39) W301* probably null Het
Or51aa2 T C 7: 103,188,031 (GRCm39) I137V probably benign Het
Or5b116 A G 19: 13,422,475 (GRCm39) Y33C probably damaging Het
Or5m9b T A 2: 85,905,882 (GRCm39) V266E probably benign Het
Or5p67 A G 7: 107,922,185 (GRCm39) S233P probably damaging Het
Or8d1 G A 9: 38,767,101 (GRCm39) V248M probably damaging Het
Otub1 C A 19: 7,177,357 (GRCm39) G67C probably damaging Het
Otx1 C A 11: 21,947,037 (GRCm39) A91S probably damaging Het
Paqr8 A G 1: 21,004,920 (GRCm39) I25V probably benign Het
Pcdh1 A G 18: 38,325,252 (GRCm39) Y897H probably damaging Het
Pde4d T G 13: 109,397,343 (GRCm39) probably benign Het
Pdzd8 C A 19: 59,289,458 (GRCm39) K647N probably damaging Het
Pnkp C T 7: 44,511,827 (GRCm39) S113L probably damaging Het
Praf2 T C X: 7,596,641 (GRCm39) probably benign Het
Pramel29 A T 4: 143,939,575 (GRCm39) probably benign Het
Psg25 A T 7: 18,258,711 (GRCm39) Y322N possibly damaging Het
Rxrg A G 1: 167,463,335 (GRCm39) E402G probably damaging Het
Selenok T A 14: 29,692,022 (GRCm39) V20E probably benign Het
Sipa1 G A 19: 5,705,786 (GRCm39) T394I probably benign Het
Spag17 A T 3: 99,969,264 (GRCm39) N1247I probably damaging Het
Spata31d1c A G 13: 65,183,718 (GRCm39) D420G probably damaging Het
Syk A G 13: 52,795,962 (GRCm39) K519R probably benign Het
Syne2 A T 12: 75,985,515 (GRCm39) E1654D possibly damaging Het
Tha1 A C 11: 117,760,502 (GRCm39) S241A probably damaging Het
Thsd7a T A 6: 12,379,601 (GRCm39) E941V probably damaging Het
Tjp1 T C 7: 64,972,797 (GRCm39) T548A probably damaging Het
Tube1 C A 10: 39,020,552 (GRCm39) D210E probably benign Het
Vmn1r183 T A 7: 23,754,971 (GRCm39) I258N possibly damaging Het
Vmn1r89 A T 7: 12,954,140 (GRCm39) N292I probably damaging Het
Vmp1 C A 11: 86,554,377 (GRCm39) V79L probably benign Het
Zfp182 T A X: 20,902,605 (GRCm39) D125V possibly damaging Het
Zfp975 T G 7: 42,311,654 (GRCm39) T320P probably damaging Het
Znrf1 G A 8: 112,263,899 (GRCm39) A43T probably benign Het
Other mutations in Il20ra
AlleleSourceChrCoordTypePredicted EffectPPH Score
IGL01929:Il20ra APN 10 19,635,019 (GRCm39) missense probably benign 0.01
IGL01936:Il20ra APN 10 19,631,591 (GRCm39) missense probably damaging 1.00
IGL01958:Il20ra APN 10 19,634,791 (GRCm39) missense probably benign 0.39
IGL02109:Il20ra APN 10 19,635,253 (GRCm39) missense possibly damaging 0.80
IGL02207:Il20ra APN 10 19,627,326 (GRCm39) missense probably damaging 0.99
IGL02234:Il20ra APN 10 19,625,018 (GRCm39) missense probably damaging 1.00
IGL02959:Il20ra APN 10 19,634,789 (GRCm39) missense probably benign 0.10
IGL03010:Il20ra APN 10 19,624,960 (GRCm39) missense probably damaging 1.00
P0017:Il20ra UTSW 10 19,635,154 (GRCm39) missense probably damaging 1.00
R0518:Il20ra UTSW 10 19,635,388 (GRCm39) missense probably damaging 1.00
R0521:Il20ra UTSW 10 19,635,388 (GRCm39) missense probably damaging 1.00
R1436:Il20ra UTSW 10 19,625,000 (GRCm39) missense probably damaging 1.00
R1714:Il20ra UTSW 10 19,631,576 (GRCm39) missense probably damaging 0.98
R1792:Il20ra UTSW 10 19,635,384 (GRCm39) missense probably damaging 0.99
R1852:Il20ra UTSW 10 19,618,767 (GRCm39) missense probably damaging 1.00
R2097:Il20ra UTSW 10 19,635,211 (GRCm39) missense probably damaging 1.00
R4559:Il20ra UTSW 10 19,625,032 (GRCm39) missense probably damaging 0.99
R4970:Il20ra UTSW 10 19,634,691 (GRCm39) missense possibly damaging 0.61
R5112:Il20ra UTSW 10 19,634,691 (GRCm39) missense possibly damaging 0.61
R6543:Il20ra UTSW 10 19,625,071 (GRCm39) missense probably damaging 1.00
R6755:Il20ra UTSW 10 19,626,542 (GRCm39) missense probably benign 0.15
R6845:Il20ra UTSW 10 19,635,059 (GRCm39) missense probably benign 0.06
R7014:Il20ra UTSW 10 19,588,458 (GRCm39) missense unknown
R7190:Il20ra UTSW 10 19,618,689 (GRCm39) missense probably damaging 0.99
R8134:Il20ra UTSW 10 19,626,452 (GRCm39) missense probably damaging 0.99
R8955:Il20ra UTSW 10 19,635,160 (GRCm39) missense possibly damaging 0.57
R9104:Il20ra UTSW 10 19,635,364 (GRCm39) missense probably benign 0.21
R9439:Il20ra UTSW 10 19,618,751 (GRCm39) missense probably benign 0.00
Predicted Primers PCR Primer
(F):5'- CATCTGTGTTTTGCTGAAGACAAAG -3'
(R):5'- TTCAGTCACACGAAGCAGCAG -3'

Sequencing Primer
(F):5'- TCATTGTAAAGCATGTAAAGGACTTC -3'
(R):5'- GCAGCAGGTCTGGTTATTCAAC -3'
Posted On 2016-07-06