Incidental Mutation 'R5267:Il20ra'
ID 401784
Institutional Source Beutler Lab
Gene Symbol Il20ra
Ensembl Gene ENSMUSG00000020007
Gene Name interleukin 20 receptor, alpha
Synonyms
MMRRC Submission 042859-MU
Accession Numbers

Ncbi RefSeq: NM_172786.2; MGI:3605069
Essential gene? Non essential (E-score: 0.000) question?
Stock # R5267 (G1)
Quality Score 183
Status Validated
Chromosome 10
Chromosomal Location 19712570-19760053 bp(+) (GRCm38)
Type of Mutation missense
DNA Base Change (assembly) A to G at 19749359 bp (GRCm38)
Zygosity Heterozygous
Amino Acid Change Threonine to Alanine at position 129 (T129A)
Ref Sequence ENSEMBL: ENSMUSP00000020185 (fasta)
Gene Model predicted gene model for transcript(s): [ENSMUST00000020185] [ENSMUST00000217389]
AlphaFold Q6PHB0
Predicted Effect probably damaging
Transcript: ENSMUST00000020185
AA Change: T129A

PolyPhen 2 Score 0.990 (Sensitivity: 0.72; Specificity: 0.97)
SMART Domains Protein: ENSMUSP00000020185
Gene: ENSMUSG00000020007
AA Change: T129A

DomainStartEndE-ValueType
Pfam:Tissue_fac 16 126 1.8e-33 PFAM
Pfam:Interfer-bind 138 243 4.6e-23 PFAM
transmembrane domain 255 277 N/A INTRINSIC
Predicted Effect probably benign
Transcript: ENSMUST00000217389
Meta Mutation Damage Score 0.6467 question?
Coding Region Coverage
  • 1x: 99.1%
  • 3x: 98.4%
  • 10x: 96.7%
  • 20x: 93.8%
Validation Efficiency 98% (86/88)
MGI Phenotype Strain: 5302406
FUNCTION: [Summary is not available for the mouse gene. This summary is for the human ortholog.] This gene encodes a member of the type II cytokine receptor family. The encoded protein is a subunit of the receptor for interleukin 20, a cytokine that may be involved in epidermal function. The interleukin 20 receptor is a heterodimeric complex consisting of the encoded protein and interleukin 20 receptor beta. This gene and interleukin 20 receptor beta are highly expressed in skin, and are upregulated in psoriasis. Alternative splicing results in multiple transcript variants. [provided by RefSeq, Jul 2013]
PHENOTYPE: Mice homozygous for a knock-out allele exhibit increased bone mineral density, impaired osteoclast differentiation, and resistance to ovariectomized-inducced bone loss. [provided by MGI curators]
Allele List at MGI

All alleles(4) : Targeted(4)
Other mutations in this stock
Total: 79 list
GeneRefVarChr/LocMutationPredicted EffectZygosity
5830473C10Rik T C 5: 90,584,857 F509S probably damaging Het
Abca12 T A 1: 71,335,774 probably benign Het
Adam15 T G 3: 89,349,899 probably benign Het
Atp12a T C 14: 56,384,211 S768P probably damaging Het
Atp8a1 G A 5: 67,762,544 T393I probably damaging Het
B4galnt4 T G 7: 141,070,611 I3S probably damaging Het
Bfsp1 G A 2: 143,827,051 T536I probably benign Het
Brsk1 G T 7: 4,704,709 W284L probably damaging Het
C87977 A T 4: 144,213,005 probably benign Het
Cadm3 A T 1: 173,337,102 D370E probably damaging Het
Cadps2 A G 6: 23,626,668 I207T possibly damaging Het
Calr4 A C 4: 109,244,076 T52P probably damaging Het
Catsperg2 G A 7: 29,717,066 T307M probably damaging Het
Ckap5 T A 2: 91,591,752 N1166K probably null Het
Clca4a G A 3: 144,953,812 T761I probably damaging Het
Cnksr3 A T 10: 7,126,633 probably null Het
Diaph3 A G 14: 86,656,553 S7P probably benign Het
Dnah7a G A 1: 53,479,692 P2969S probably damaging Het
Dnaic2 A T 11: 114,740,467 T221S probably benign Het
Dsc2 A G 18: 20,034,583 probably null Het
Eif4g1 A G 16: 20,685,533 N789S probably damaging Het
Fn1 C T 1: 71,629,704 R694H probably damaging Het
Gm5478 G A 15: 101,644,402 R365C probably damaging Het
Gm5591 A T 7: 38,518,914 M845K possibly damaging Het
Gm5800 A T 14: 51,713,837 probably null Het
Gprc5c G T 11: 114,864,267 V257L possibly damaging Het
H2-Q2 A T 17: 35,343,179 Y134F probably benign Het
Hcfc1r1 A G 17: 23,674,674 R76G possibly damaging Het
Hectd4 T C 5: 121,344,824 I3146T probably benign Het
Herc1 G T 9: 66,461,809 L2928F probably damaging Het
Hmx3 C T 7: 131,544,169 A202V probably benign Het
Ikzf3 A T 11: 98,490,580 M58K probably benign Het
Il21 T C 3: 37,227,797 H66R probably benign Het
Kcnh5 A T 12: 75,087,416 M453K probably damaging Het
Kdf1 C G 4: 133,528,947 A325G probably damaging Het
Klhl10 C T 11: 100,447,221 A262V probably benign Het
Krt81 T A 15: 101,459,459 N464I probably benign Het
Ksr1 A T 11: 79,020,425 I698N probably damaging Het
Lrp2 A G 2: 69,548,978 V130A possibly damaging Het
Mcm2 T C 6: 88,897,450 T25A probably benign Het
Mrps18c T A 5: 100,803,094 Y93* probably null Het
Mycl C T 4: 123,000,496 A363V probably damaging Het
Mylk2 C A 2: 152,913,549 A211E probably benign Het
Myo5a G A 9: 75,152,010 D507N probably damaging Het
Myo7b A G 18: 31,998,734 F470L probably damaging Het
Oas1a A T 5: 120,899,221 C248S probably benign Het
Olfr1036 T A 2: 86,075,538 V266E probably benign Het
Olfr1229 C T 2: 89,282,230 W301* probably null Het
Olfr1471 A G 19: 13,445,111 Y33C probably damaging Het
Olfr26 G A 9: 38,855,805 V248M probably damaging Het
Olfr492 A G 7: 108,322,978 S233P probably damaging Het
Olfr612 T C 7: 103,538,824 I137V probably benign Het
Olfr701 T C 7: 106,818,808 S242P probably damaging Het
Otub1 C A 19: 7,199,992 G67C probably damaging Het
Otx1 C A 11: 21,997,037 A91S probably damaging Het
Paqr8 A G 1: 20,934,696 I25V probably benign Het
Pcdh1 A G 18: 38,192,199 Y897H probably damaging Het
Pde4d T G 13: 109,260,809 probably benign Het
Pdzd8 C A 19: 59,301,026 K647N probably damaging Het
Pnkp C T 7: 44,862,403 S113L probably damaging Het
Praf2 T C X: 7,730,402 probably benign Het
Psg25 A T 7: 18,524,786 Y322N possibly damaging Het
Rxrg A G 1: 167,635,766 E402G probably damaging Het
Selenok T A 14: 29,970,065 V20E probably benign Het
Sipa1 G A 19: 5,655,758 T394I probably benign Het
Spag17 A T 3: 100,061,948 N1247I probably damaging Het
Spata31d1c A G 13: 65,035,904 D420G probably damaging Het
Syk A G 13: 52,641,926 K519R probably benign Het
Syne2 A T 12: 75,938,741 E1654D possibly damaging Het
Tha1 A C 11: 117,869,676 S241A probably damaging Het
Thsd7a T A 6: 12,379,602 E941V probably damaging Het
Tjp1 T C 7: 65,323,049 T548A probably damaging Het
Tube1 C A 10: 39,144,556 D210E probably benign Het
Vmn1r183 T A 7: 24,055,546 I258N possibly damaging Het
Vmn1r89 A T 7: 13,220,213 N292I probably damaging Het
Vmp1 C A 11: 86,663,551 V79L probably benign Het
Zfp182 T A X: 21,036,366 D125V possibly damaging Het
Zfp975 T G 7: 42,662,230 T320P probably damaging Het
Znrf1 G A 8: 111,537,267 A43T probably benign Het
Other mutations in Il20ra
AlleleSourceChrCoordTypePredicted EffectPPH Score
IGL01929:Il20ra APN 10 19759271 missense probably benign 0.01
IGL01936:Il20ra APN 10 19755843 missense probably damaging 1.00
IGL01958:Il20ra APN 10 19759043 missense probably benign 0.39
IGL02109:Il20ra APN 10 19759505 missense possibly damaging 0.80
IGL02207:Il20ra APN 10 19751578 missense probably damaging 0.99
IGL02234:Il20ra APN 10 19749270 missense probably damaging 1.00
IGL02959:Il20ra APN 10 19759041 missense probably benign 0.10
IGL03010:Il20ra APN 10 19749212 missense probably damaging 1.00
P0017:Il20ra UTSW 10 19759406 missense probably damaging 1.00
R0518:Il20ra UTSW 10 19759640 missense probably damaging 1.00
R0521:Il20ra UTSW 10 19759640 missense probably damaging 1.00
R1436:Il20ra UTSW 10 19749252 missense probably damaging 1.00
R1714:Il20ra UTSW 10 19755828 missense probably damaging 0.98
R1792:Il20ra UTSW 10 19759636 missense probably damaging 0.99
R1852:Il20ra UTSW 10 19743019 missense probably damaging 1.00
R2097:Il20ra UTSW 10 19759463 missense probably damaging 1.00
R4559:Il20ra UTSW 10 19749284 missense probably damaging 0.99
R4970:Il20ra UTSW 10 19758943 missense possibly damaging 0.61
R5112:Il20ra UTSW 10 19758943 missense possibly damaging 0.61
R6543:Il20ra UTSW 10 19749323 missense probably damaging 1.00
R6755:Il20ra UTSW 10 19750794 missense probably benign 0.15
R6845:Il20ra UTSW 10 19759311 missense probably benign 0.06
R7014:Il20ra UTSW 10 19712710 missense unknown
R7190:Il20ra UTSW 10 19742941 missense probably damaging 0.99
R8134:Il20ra UTSW 10 19750704 missense probably damaging 0.99
R8955:Il20ra UTSW 10 19759412 missense possibly damaging 0.57
R9104:Il20ra UTSW 10 19759616 missense probably benign 0.21
R9439:Il20ra UTSW 10 19743003 missense probably benign 0.00
Predicted Primers PCR Primer
(F):5'- CATCTGTGTTTTGCTGAAGACAAAG -3'
(R):5'- TTCAGTCACACGAAGCAGCAG -3'

Sequencing Primer
(F):5'- TCATTGTAAAGCATGTAAAGGACTTC -3'
(R):5'- GCAGCAGGTCTGGTTATTCAAC -3'
Posted On 2016-07-06