Incidental Mutation 'R5267:Gprc5c'
ID 401793
Institutional Source Beutler Lab
Gene Symbol Gprc5c
Ensembl Gene ENSMUSG00000051043
Gene Name G protein-coupled receptor, family C, group 5, member C
Synonyms
MMRRC Submission 042859-MU
Accession Numbers
Is this an essential gene? Possibly non essential (E-score: 0.302) question?
Stock # R5267 (G1)
Quality Score 225
Status Validated
Chromosome 11
Chromosomal Location 114851152-114872617 bp(+) (GRCm38)
Type of Mutation missense
DNA Base Change (assembly) G to T at 114864267 bp (GRCm38)
Zygosity Heterozygous
Amino Acid Change Valine to Leucine at position 257 (V257L)
Ref Sequence ENSEMBL: ENSMUSP00000061760 (fasta)
Gene Model predicted gene model for transcript(s): [ENSMUST00000021071] [ENSMUST00000053361] [ENSMUST00000122967] [ENSMUST00000133245] [ENSMUST00000136785] [ENSMUST00000142262] [ENSMUST00000152314] [ENSMUST00000177952]
AlphaFold no structure available at present
Predicted Effect possibly damaging
Transcript: ENSMUST00000021071
AA Change: V257L

PolyPhen 2 Score 0.834 (Sensitivity: 0.84; Specificity: 0.93)
SMART Domains Protein: ENSMUSP00000021071
Gene: ENSMUSG00000051043
AA Change: V257L

DomainStartEndE-ValueType
signal peptide 1 22 N/A INTRINSIC
Pfam:7tm_3 58 302 1.3e-42 PFAM
Predicted Effect possibly damaging
Transcript: ENSMUST00000053361
AA Change: V257L

PolyPhen 2 Score 0.921 (Sensitivity: 0.81; Specificity: 0.94)
SMART Domains Protein: ENSMUSP00000061760
Gene: ENSMUSG00000051043
AA Change: V257L

DomainStartEndE-ValueType
signal peptide 1 22 N/A INTRINSIC
Pfam:7tm_3 60 301 1.3e-28 PFAM
Predicted Effect probably benign
Transcript: ENSMUST00000122967
SMART Domains Protein: ENSMUSP00000114335
Gene: ENSMUSG00000051043

DomainStartEndE-ValueType
signal peptide 1 22 N/A INTRINSIC
transmembrane domain 55 77 N/A INTRINSIC
Predicted Effect probably benign
Transcript: ENSMUST00000133245
SMART Domains Protein: ENSMUSP00000121572
Gene: ENSMUSG00000051043

DomainStartEndE-ValueType
signal peptide 1 22 N/A INTRINSIC
transmembrane domain 55 77 N/A INTRINSIC
Predicted Effect possibly damaging
Transcript: ENSMUST00000136785
AA Change: V257L

PolyPhen 2 Score 0.852 (Sensitivity: 0.83; Specificity: 0.93)
SMART Domains Protein: ENSMUSP00000116786
Gene: ENSMUSG00000051043
AA Change: V257L

DomainStartEndE-ValueType
signal peptide 1 22 N/A INTRINSIC
Pfam:7tm_3 58 283 1.5e-38 PFAM
Predicted Effect probably benign
Transcript: ENSMUST00000142262
SMART Domains Protein: ENSMUSP00000121524
Gene: ENSMUSG00000051043

DomainStartEndE-ValueType
signal peptide 1 22 N/A INTRINSIC
Pfam:7tm_3 58 133 6.2e-14 PFAM
Predicted Effect probably benign
Transcript: ENSMUST00000152314
Predicted Effect possibly damaging
Transcript: ENSMUST00000177952
AA Change: V257L

PolyPhen 2 Score 0.834 (Sensitivity: 0.84; Specificity: 0.93)
SMART Domains Protein: ENSMUSP00000136702
Gene: ENSMUSG00000051043
AA Change: V257L

DomainStartEndE-ValueType
signal peptide 1 22 N/A INTRINSIC
Pfam:7tm_3 58 302 1.3e-42 PFAM
Meta Mutation Damage Score 0.1280 question?
Coding Region Coverage
  • 1x: 99.1%
  • 3x: 98.4%
  • 10x: 96.7%
  • 20x: 93.8%
Validation Efficiency 98% (86/88)
MGI Phenotype FUNCTION: [Summary is not available for the mouse gene. This summary is for the human ortholog.] The protein encoded by this gene is a member of the type 3 G protein-coupled receptor family. Members of this superfamily are characterized by a signature 7-transmembrane domain motif. The specific function of this protein is unknown; however, this protein may mediate the cellular effects of retinoic acid on the G protein signal transduction cascade. Two transcript variants encoding different isoforms have been found for this gene. [provided by RefSeq, Jul 2008]
PHENOTYPE: Mice homozygous for a reporter allele are behaviorally normal but exhibit reticulocytosis, increased mean corpuscular volume, increased percentage of basophils, decreased mean corpuscular hemogloblin concentration, and increased alkaline phophatase and lactic dehydrogenase levels. [provided by MGI curators]
Allele List at MGI
Other mutations in this stock
Total: 79 list
GeneRefVarChr/LocMutationPredicted EffectZygosity
5830473C10Rik T C 5: 90,584,857 F509S probably damaging Het
Abca12 T A 1: 71,335,774 probably benign Het
Adam15 T G 3: 89,349,899 probably benign Het
Atp12a T C 14: 56,384,211 S768P probably damaging Het
Atp8a1 G A 5: 67,762,544 T393I probably damaging Het
B4galnt4 T G 7: 141,070,611 I3S probably damaging Het
Bfsp1 G A 2: 143,827,051 T536I probably benign Het
Brsk1 G T 7: 4,704,709 W284L probably damaging Het
C87977 A T 4: 144,213,005 probably benign Het
Cadm3 A T 1: 173,337,102 D370E probably damaging Het
Cadps2 A G 6: 23,626,668 I207T possibly damaging Het
Calr4 A C 4: 109,244,076 T52P probably damaging Het
Catsperg2 G A 7: 29,717,066 T307M probably damaging Het
Ckap5 T A 2: 91,591,752 N1166K probably null Het
Clca4a G A 3: 144,953,812 T761I probably damaging Het
Cnksr3 A T 10: 7,126,633 probably null Het
Diaph3 A G 14: 86,656,553 S7P probably benign Het
Dnah7a G A 1: 53,479,692 P2969S probably damaging Het
Dnaic2 A T 11: 114,740,467 T221S probably benign Het
Dsc2 A G 18: 20,034,583 probably null Het
Eif4g1 A G 16: 20,685,533 N789S probably damaging Het
Fn1 C T 1: 71,629,704 R694H probably damaging Het
Gm5478 G A 15: 101,644,402 R365C probably damaging Het
Gm5591 A T 7: 38,518,914 M845K possibly damaging Het
Gm5800 A T 14: 51,713,837 probably null Het
H2-Q2 A T 17: 35,343,179 Y134F probably benign Het
Hcfc1r1 A G 17: 23,674,674 R76G possibly damaging Het
Hectd4 T C 5: 121,344,824 I3146T probably benign Het
Herc1 G T 9: 66,461,809 L2928F probably damaging Het
Hmx3 C T 7: 131,544,169 A202V probably benign Het
Ikzf3 A T 11: 98,490,580 M58K probably benign Het
Il20ra A G 10: 19,749,359 T129A probably damaging Het
Il21 T C 3: 37,227,797 H66R probably benign Het
Kcnh5 A T 12: 75,087,416 M453K probably damaging Het
Kdf1 C G 4: 133,528,947 A325G probably damaging Het
Klhl10 C T 11: 100,447,221 A262V probably benign Het
Krt81 T A 15: 101,459,459 N464I probably benign Het
Ksr1 A T 11: 79,020,425 I698N probably damaging Het
Lrp2 A G 2: 69,548,978 V130A possibly damaging Het
Mcm2 T C 6: 88,897,450 T25A probably benign Het
Mrps18c T A 5: 100,803,094 Y93* probably null Het
Mycl C T 4: 123,000,496 A363V probably damaging Het
Mylk2 C A 2: 152,913,549 A211E probably benign Het
Myo5a G A 9: 75,152,010 D507N probably damaging Het
Myo7b A G 18: 31,998,734 F470L probably damaging Het
Oas1a A T 5: 120,899,221 C248S probably benign Het
Olfr1036 T A 2: 86,075,538 V266E probably benign Het
Olfr1229 C T 2: 89,282,230 W301* probably null Het
Olfr1471 A G 19: 13,445,111 Y33C probably damaging Het
Olfr26 G A 9: 38,855,805 V248M probably damaging Het
Olfr492 A G 7: 108,322,978 S233P probably damaging Het
Olfr612 T C 7: 103,538,824 I137V probably benign Het
Olfr701 T C 7: 106,818,808 S242P probably damaging Het
Otub1 C A 19: 7,199,992 G67C probably damaging Het
Otx1 C A 11: 21,997,037 A91S probably damaging Het
Paqr8 A G 1: 20,934,696 I25V probably benign Het
Pcdh1 A G 18: 38,192,199 Y897H probably damaging Het
Pde4d T G 13: 109,260,809 probably benign Het
Pdzd8 C A 19: 59,301,026 K647N probably damaging Het
Pnkp C T 7: 44,862,403 S113L probably damaging Het
Praf2 T C X: 7,730,402 probably benign Het
Psg25 A T 7: 18,524,786 Y322N possibly damaging Het
Rxrg A G 1: 167,635,766 E402G probably damaging Het
Selenok T A 14: 29,970,065 V20E probably benign Het
Sipa1 G A 19: 5,655,758 T394I probably benign Het
Spag17 A T 3: 100,061,948 N1247I probably damaging Het
Spata31d1c A G 13: 65,035,904 D420G probably damaging Het
Syk A G 13: 52,641,926 K519R probably benign Het
Syne2 A T 12: 75,938,741 E1654D possibly damaging Het
Tha1 A C 11: 117,869,676 S241A probably damaging Het
Thsd7a T A 6: 12,379,602 E941V probably damaging Het
Tjp1 T C 7: 65,323,049 T548A probably damaging Het
Tube1 C A 10: 39,144,556 D210E probably benign Het
Vmn1r183 T A 7: 24,055,546 I258N possibly damaging Het
Vmn1r89 A T 7: 13,220,213 N292I probably damaging Het
Vmp1 C A 11: 86,663,551 V79L probably benign Het
Zfp182 T A X: 21,036,366 D125V possibly damaging Het
Zfp975 T G 7: 42,662,230 T320P probably damaging Het
Znrf1 G A 8: 111,537,267 A43T probably benign Het
Other mutations in Gprc5c
AlleleSourceChrCoordTypePredicted EffectPPH Score
IGL01599:Gprc5c APN 11 114864252 missense probably benign 0.01
IGL01762:Gprc5c APN 11 114864024 missense probably benign 0.28
IGL02039:Gprc5c APN 11 114864486 nonsense probably null
R0800:Gprc5c UTSW 11 114866711 missense probably damaging 0.99
R1618:Gprc5c UTSW 11 114864394 missense possibly damaging 0.88
R4198:Gprc5c UTSW 11 114863860 missense probably damaging 1.00
R4807:Gprc5c UTSW 11 114864498 missense probably damaging 0.97
R4846:Gprc5c UTSW 11 114864267 missense possibly damaging 0.92
R4902:Gprc5c UTSW 11 114864267 missense possibly damaging 0.92
R4904:Gprc5c UTSW 11 114864267 missense possibly damaging 0.92
R5016:Gprc5c UTSW 11 114864267 missense possibly damaging 0.92
R5048:Gprc5c UTSW 11 114870351 makesense probably null
R5106:Gprc5c UTSW 11 114864267 missense possibly damaging 0.92
R5109:Gprc5c UTSW 11 114864267 missense possibly damaging 0.92
R5173:Gprc5c UTSW 11 114864267 missense possibly damaging 0.92
R5266:Gprc5c UTSW 11 114864267 missense possibly damaging 0.92
R5475:Gprc5c UTSW 11 114864267 missense possibly damaging 0.92
R5508:Gprc5c UTSW 11 114864267 missense possibly damaging 0.92
R5557:Gprc5c UTSW 11 114864267 missense possibly damaging 0.92
R5562:Gprc5c UTSW 11 114864267 missense possibly damaging 0.92
R5563:Gprc5c UTSW 11 114864267 missense possibly damaging 0.92
R5598:Gprc5c UTSW 11 114864267 missense possibly damaging 0.92
R5599:Gprc5c UTSW 11 114864267 missense possibly damaging 0.92
R5729:Gprc5c UTSW 11 114864267 missense possibly damaging 0.92
R5756:Gprc5c UTSW 11 114864267 missense possibly damaging 0.92
R5792:Gprc5c UTSW 11 114864267 missense possibly damaging 0.92
R5793:Gprc5c UTSW 11 114864267 missense possibly damaging 0.92
R5794:Gprc5c UTSW 11 114864267 missense possibly damaging 0.92
R5817:Gprc5c UTSW 11 114863624 nonsense probably null
R5976:Gprc5c UTSW 11 114864487 missense possibly damaging 0.89
R6151:Gprc5c UTSW 11 114864025 missense probably damaging 1.00
R6617:Gprc5c UTSW 11 114864105 missense probably benign 0.05
R7108:Gprc5c UTSW 11 114864282 missense probably damaging 1.00
R7191:Gprc5c UTSW 11 114868617 missense possibly damaging 0.56
R7796:Gprc5c UTSW 11 114864532 missense probably damaging 0.97
R8543:Gprc5c UTSW 11 114864268 missense probably damaging 1.00
Predicted Primers PCR Primer
(F):5'- AATGTCAGTGCCGACTCGAC -3'
(R):5'- AAATGCCTTGTTCTCCACAAACATG -3'

Sequencing Primer
(F):5'- GACCATGACCTCTCCGTGTG -3'
(R):5'- TCAGGATGGTCTCATAGCCCAC -3'
Posted On 2016-07-06