Incidental Mutation 'R5267:Myo7b'
ID401809
Institutional Source Beutler Lab
Gene Symbol Myo7b
Ensembl Gene ENSMUSG00000024388
Gene Namemyosin VIIB
Synonyms
MMRRC Submission 042859-MU
Accession Numbers
Is this an essential gene? Non essential (E-score: 0.000) question?
Stock #R5267 (G1)
Quality Score165
Status Validated
Chromosome18
Chromosomal Location31959234-32036961 bp(-) (GRCm38)
Type of Mutationmissense
DNA Base Change (assembly) A to G at 31998734 bp
ZygosityHeterozygous
Amino Acid Change Phenylalanine to Leucine at position 470 (F470L)
Ref Sequence ENSEMBL: ENSMUSP00000118046 (fasta)
Gene Model predicted gene model for transcript(s): [ENSMUST00000134663]
Predicted Effect probably damaging
Transcript: ENSMUST00000134663
AA Change: F470L

PolyPhen 2 Score 0.999 (Sensitivity: 0.14; Specificity: 0.99)
SMART Domains Protein: ENSMUSP00000118046
Gene: ENSMUSG00000024388
AA Change: F470L

DomainStartEndE-ValueType
MYSc 59 761 N/A SMART
IQ 762 784 1.07e-1 SMART
IQ 785 807 7.01e-6 SMART
IQ 831 853 4.93e-1 SMART
IQ 854 876 1.63e-1 SMART
MyTH4 989 1189 1.14e-71 SMART
B41 1190 1409 3.66e-16 SMART
SH3 1501 1563 3.25e-7 SMART
MyTH4 1641 1790 7.66e-55 SMART
B41 1792 2009 8.19e-28 SMART
Meta Mutation Damage Score 0.8824 question?
Coding Region Coverage
  • 1x: 99.1%
  • 3x: 98.4%
  • 10x: 96.7%
  • 20x: 93.8%
Validation Efficiency 98% (86/88)
MGI Phenotype FUNCTION: [Summary is not available for the mouse gene. This summary is for the human ortholog.] The protein encoded by this gene is found in brush border microvilli of epithelial cells in the intestines and kidneys. The encoded protein is involved in linking protocadherins to the actin cytoskeleton and is essential for proper microvilli function. This protein aids in the accumulation of intermicrovillar adhesion components such as harmonin and ANKS4B, and this accumulation is necessary for normal brush border action. [provided by RefSeq, Jan 2017]
Allele List at MGI
Other mutations in this stock
Total: 79 list
GeneRefVarChr/LocMutationPredicted EffectZygosity
5830473C10Rik T C 5: 90,584,857 F509S probably damaging Het
Abca12 T A 1: 71,335,774 probably benign Het
Adam15 T G 3: 89,349,899 probably benign Het
Atp12a T C 14: 56,384,211 S768P probably damaging Het
Atp8a1 G A 5: 67,762,544 T393I probably damaging Het
B4galnt4 T G 7: 141,070,611 I3S probably damaging Het
Bfsp1 G A 2: 143,827,051 T536I probably benign Het
Brsk1 G T 7: 4,704,709 W284L probably damaging Het
C87977 A T 4: 144,213,005 probably benign Het
Cadm3 A T 1: 173,337,102 D370E probably damaging Het
Cadps2 A G 6: 23,626,668 I207T possibly damaging Het
Calr4 A C 4: 109,244,076 T52P probably damaging Het
Catsperg2 G A 7: 29,717,066 T307M probably damaging Het
Ckap5 T A 2: 91,591,752 N1166K probably null Het
Clca4a G A 3: 144,953,812 T761I probably damaging Het
Cnksr3 A T 10: 7,126,633 probably null Het
Diaph3 A G 14: 86,656,553 S7P probably benign Het
Dnah7a G A 1: 53,479,692 P2969S probably damaging Het
Dnaic2 A T 11: 114,740,467 T221S probably benign Het
Dsc2 A G 18: 20,034,583 probably null Het
Eif4g1 A G 16: 20,685,533 N789S probably damaging Het
Fn1 C T 1: 71,629,704 R694H probably damaging Het
Gm5478 G A 15: 101,644,402 R365C probably damaging Het
Gm5591 A T 7: 38,518,914 M845K possibly damaging Het
Gm5800 A T 14: 51,713,837 probably null Het
Gprc5c G T 11: 114,864,267 V257L possibly damaging Het
H2-Q2 A T 17: 35,343,179 Y134F probably benign Het
Hcfc1r1 A G 17: 23,674,674 R76G possibly damaging Het
Hectd4 T C 5: 121,344,824 I3146T probably benign Het
Herc1 G T 9: 66,461,809 L2928F probably damaging Het
Hmx3 C T 7: 131,544,169 A202V probably benign Het
Ikzf3 A T 11: 98,490,580 M58K probably benign Het
Il20ra A G 10: 19,749,359 T129A probably damaging Het
Il21 T C 3: 37,227,797 H66R probably benign Het
Kcnh5 A T 12: 75,087,416 M453K probably damaging Het
Kdf1 C G 4: 133,528,947 A325G probably damaging Het
Klhl10 C T 11: 100,447,221 A262V probably benign Het
Krt81 T A 15: 101,459,459 N464I probably benign Het
Ksr1 A T 11: 79,020,425 I698N probably damaging Het
Lrp2 A G 2: 69,548,978 V130A possibly damaging Het
Mcm2 T C 6: 88,897,450 T25A probably benign Het
Mrps18c T A 5: 100,803,094 Y93* probably null Het
Mycl C T 4: 123,000,496 A363V probably damaging Het
Mylk2 C A 2: 152,913,549 A211E probably benign Het
Myo5a G A 9: 75,152,010 D507N probably damaging Het
Oas1a A T 5: 120,899,221 C248S probably benign Het
Olfr1036 T A 2: 86,075,538 V266E probably benign Het
Olfr1229 C T 2: 89,282,230 W301* probably null Het
Olfr1471 A G 19: 13,445,111 Y33C probably damaging Het
Olfr26 G A 9: 38,855,805 V248M probably damaging Het
Olfr492 A G 7: 108,322,978 S233P probably damaging Het
Olfr612 T C 7: 103,538,824 I137V probably benign Het
Olfr701 T C 7: 106,818,808 S242P probably damaging Het
Otub1 C A 19: 7,199,992 G67C probably damaging Het
Otx1 C A 11: 21,997,037 A91S probably damaging Het
Paqr8 A G 1: 20,934,696 I25V probably benign Het
Pcdh1 A G 18: 38,192,199 Y897H probably damaging Het
Pde4d T G 13: 109,260,809 probably benign Het
Pdzd8 C A 19: 59,301,026 K647N probably damaging Het
Pnkp C T 7: 44,862,403 S113L probably damaging Het
Praf2 T C X: 7,730,402 probably benign Het
Psg25 A T 7: 18,524,786 Y322N possibly damaging Het
Rxrg A G 1: 167,635,766 E402G probably damaging Het
Selenok T A 14: 29,970,065 V20E probably benign Het
Sipa1 G A 19: 5,655,758 T394I probably benign Het
Spag17 A T 3: 100,061,948 N1247I probably damaging Het
Spata31d1c A G 13: 65,035,904 D420G probably damaging Het
Syk A G 13: 52,641,926 K519R probably benign Het
Syne2 A T 12: 75,938,741 E1654D possibly damaging Het
Tha1 A C 11: 117,869,676 S241A probably damaging Het
Thsd7a T A 6: 12,379,602 E941V probably damaging Het
Tjp1 T C 7: 65,323,049 T548A probably damaging Het
Tube1 C A 10: 39,144,556 D210E probably benign Het
Vmn1r183 T A 7: 24,055,546 I258N possibly damaging Het
Vmn1r89 A T 7: 13,220,213 N292I probably damaging Het
Vmp1 C A 11: 86,663,551 V79L probably benign Het
Zfp182 T A X: 21,036,366 D125V possibly damaging Het
Zfp975 T G 7: 42,662,230 T320P probably damaging Het
Znrf1 G A 8: 111,537,267 A43T probably benign Het
Other mutations in Myo7b
AlleleSourceChrCoordTypePredicted EffectPPH Score
IGL00391:Myo7b APN 18 32021556 utr 5 prime probably benign
IGL01799:Myo7b APN 18 31962770 missense probably damaging 1.00
IGL01881:Myo7b APN 18 32000267 splice site probably benign
IGL01883:Myo7b APN 18 31998151 missense probably damaging 1.00
IGL01934:Myo7b APN 18 32001341 critical splice donor site probably null
IGL01980:Myo7b APN 18 31961900 missense possibly damaging 0.86
IGL02506:Myo7b APN 18 31967154 missense probably damaging 1.00
IGL02704:Myo7b APN 18 31966961 missense probably benign 0.13
IGL02929:Myo7b APN 18 31994925 missense probably benign 0.19
IGL03149:Myo7b APN 18 32014302 missense probably damaging 1.00
IGL03335:Myo7b APN 18 31985020 missense possibly damaging 0.81
IGL03372:Myo7b APN 18 31998601 missense probably damaging 1.00
IGL03385:Myo7b APN 18 31989577 missense probably benign 0.00
PIT4131001:Myo7b UTSW 18 31961206 missense probably benign 0.17
PIT4445001:Myo7b UTSW 18 31959466 missense possibly damaging 0.80
PIT4445001:Myo7b UTSW 18 31962352 missense probably damaging 0.96
R0034:Myo7b UTSW 18 31960860 missense probably damaging 1.00
R0138:Myo7b UTSW 18 32010151 missense probably damaging 1.00
R0149:Myo7b UTSW 18 32014209 missense probably damaging 1.00
R0226:Myo7b UTSW 18 31972896 missense probably benign 0.00
R0312:Myo7b UTSW 18 32014337 missense possibly damaging 0.68
R0361:Myo7b UTSW 18 32014209 missense probably damaging 1.00
R0506:Myo7b UTSW 18 31964386 critical splice donor site probably null
R0524:Myo7b UTSW 18 32013424 missense possibly damaging 0.91
R0645:Myo7b UTSW 18 31994909 missense probably benign 0.10
R0724:Myo7b UTSW 18 32005549 splice site probably benign
R0731:Myo7b UTSW 18 31961825 splice site probably null
R0762:Myo7b UTSW 18 31983944 missense probably benign 0.01
R0843:Myo7b UTSW 18 31974084 missense possibly damaging 0.83
R0894:Myo7b UTSW 18 32000070 missense probably damaging 1.00
R0966:Myo7b UTSW 18 31998763 missense probably damaging 1.00
R1205:Myo7b UTSW 18 31994342 missense probably damaging 1.00
R1387:Myo7b UTSW 18 31983752 splice site probably benign
R1523:Myo7b UTSW 18 31966876 missense probably damaging 1.00
R1544:Myo7b UTSW 18 31994909 missense probably benign 0.10
R1623:Myo7b UTSW 18 32000051 missense probably damaging 1.00
R1780:Myo7b UTSW 18 31961185 missense probably damaging 1.00
R1785:Myo7b UTSW 18 31994897 missense probably benign
R1786:Myo7b UTSW 18 31994897 missense probably benign
R1796:Myo7b UTSW 18 31986675 missense possibly damaging 0.93
R1907:Myo7b UTSW 18 31976999 missense possibly damaging 0.89
R2027:Myo7b UTSW 18 31984960 missense probably benign
R2102:Myo7b UTSW 18 31999978 missense probably damaging 1.00
R2174:Myo7b UTSW 18 31983557 missense probably damaging 1.00
R2272:Myo7b UTSW 18 31977043 missense probably benign 0.41
R2323:Myo7b UTSW 18 31971345 missense probably damaging 1.00
R2365:Myo7b UTSW 18 32014331 missense probably damaging 0.98
R3078:Myo7b UTSW 18 31967184 missense probably benign 0.04
R3522:Myo7b UTSW 18 32010079 missense probably damaging 1.00
R3788:Myo7b UTSW 18 31974112 missense possibly damaging 0.95
R3880:Myo7b UTSW 18 31969514 missense probably damaging 0.96
R4334:Myo7b UTSW 18 31976987 missense probably damaging 1.00
R4343:Myo7b UTSW 18 31983627 missense probably damaging 1.00
R4497:Myo7b UTSW 18 32014229 missense probably benign 0.06
R4498:Myo7b UTSW 18 32014229 missense probably benign 0.06
R4551:Myo7b UTSW 18 31985108 missense probably benign 0.01
R4593:Myo7b UTSW 18 32013375 missense possibly damaging 0.77
R4616:Myo7b UTSW 18 32003487 splice site probably null
R4646:Myo7b UTSW 18 31994369 missense probably benign 0.25
R4648:Myo7b UTSW 18 31967125 splice site probably null
R4737:Myo7b UTSW 18 31998602 missense probably damaging 1.00
R4765:Myo7b UTSW 18 31961900 missense probably benign 0.00
R4790:Myo7b UTSW 18 32000105 splice site probably null
R4909:Myo7b UTSW 18 31964436 missense probably benign 0.01
R5027:Myo7b UTSW 18 31975212 missense probably benign 0.22
R5034:Myo7b UTSW 18 31971387 missense probably damaging 1.00
R5112:Myo7b UTSW 18 31983587 missense probably damaging 1.00
R5266:Myo7b UTSW 18 31998734 missense probably damaging 1.00
R5348:Myo7b UTSW 18 31983919 missense probably damaging 0.96
R5457:Myo7b UTSW 18 31971450 splice site probably null
R5540:Myo7b UTSW 18 32007090 missense probably damaging 1.00
R5628:Myo7b UTSW 18 31974187 missense probably benign
R5815:Myo7b UTSW 18 31966288 missense probably damaging 1.00
R6062:Myo7b UTSW 18 31967990 missense possibly damaging 0.94
R6137:Myo7b UTSW 18 31999974 missense probably damaging 1.00
R6158:Myo7b UTSW 18 31988549 missense probably benign 0.00
R6218:Myo7b UTSW 18 31959454 missense probably benign 0.10
R6256:Myo7b UTSW 18 31983695 missense probably damaging 1.00
R6257:Myo7b UTSW 18 32013415 missense probably damaging 1.00
R6265:Myo7b UTSW 18 31998150 missense probably damaging 1.00
R6302:Myo7b UTSW 18 31994386 missense probably damaging 0.98
R6438:Myo7b UTSW 18 31966329 missense probably damaging 1.00
R6654:Myo7b UTSW 18 31990269 missense possibly damaging 0.46
R7030:Myo7b UTSW 18 31971573 missense probably damaging 1.00
R7090:Myo7b UTSW 18 31998712 missense probably damaging 1.00
R7210:Myo7b UTSW 18 32007102 missense probably damaging 1.00
R7218:Myo7b UTSW 18 31981001 missense probably benign 0.05
R7378:Myo7b UTSW 18 31966239 missense probably damaging 1.00
R7458:Myo7b UTSW 18 31988551 missense possibly damaging 0.89
R7517:Myo7b UTSW 18 32013267 missense probably damaging 0.99
R7559:Myo7b UTSW 18 31983360 missense probably benign 0.01
R7667:Myo7b UTSW 18 31961905 missense probably benign
R7737:Myo7b UTSW 18 32014204 nonsense probably null
R7942:Myo7b UTSW 18 32013369 missense probably damaging 0.98
R8030:Myo7b UTSW 18 31998082 missense probably damaging 0.96
R8114:Myo7b UTSW 18 31965624 missense probably damaging 1.00
R8338:Myo7b UTSW 18 31971355 missense probably damaging 0.96
R8341:Myo7b UTSW 18 31983926 missense probably benign 0.39
R8406:Myo7b UTSW 18 31959813 missense probably damaging 1.00
R8464:Myo7b UTSW 18 31962704 missense probably benign 0.00
R8517:Myo7b UTSW 18 31967191 missense possibly damaging 0.87
R8537:Myo7b UTSW 18 31977089 missense probably benign 0.08
R8546:Myo7b UTSW 18 31990148 missense probably benign 0.19
R8721:Myo7b UTSW 18 32007011 missense probably damaging 1.00
R8770:Myo7b UTSW 18 31981071 missense probably benign 0.03
R8841:Myo7b UTSW 18 31964437 missense probably benign 0.06
R8853:Myo7b UTSW 18 31986691 missense possibly damaging 0.67
X0027:Myo7b UTSW 18 31965636 missense probably damaging 1.00
Z1176:Myo7b UTSW 18 31980998 missense possibly damaging 0.82
Z1177:Myo7b UTSW 18 31985056 missense probably damaging 1.00
Predicted Primers PCR Primer
(F):5'- TGCTTGACCTCTGAGGAGAG -3'
(R):5'- ACCCATGAGGCTTTGTGTG -3'

Sequencing Primer
(F):5'- GACTCAGAAAGTAGGTTGTATTCAG -3'
(R):5'- CATGTGGCATATGTCTGGGGC -3'
Posted On2016-07-06