Mutagenetix > Incidental Mutation

Incidental Mutation 'R0414:Lrrn3'

40182

Institutional Source

Beutler Lab

Gene Symbol

Lrrn3

Ensembl Gene

ENSMUSG00000036295

Gene Name

leucine rich repeat protein 3, neuronal

Synonyms

NLRR-3

MMRRC Submission

038616-MU

Accession Numbers

Essential gene?

Probably non essential (E-score: 0.203) question?

Stock #

R0414 (G1)

Quality Score

225

Status

Validated

Chromosome

Chromosomal Location

41451668-41486431 bp(-) (GRCm38)

Type of Mutation

missense

DNA Base Change (assembly)

T to A at 41453940 bp (GRCm38)

Zygosity

Heterozygous

Amino Acid Change

Asparagine to Isoleucine at position 126 (N126I)

Ref Sequence

ENSEMBL: ENSMUSP00000043818 (fasta)

Gene Model

predicted gene model for transcript(s): [ENSMUST00000043884] [ENSMUST00000132121] [ENSMUST00000134965]

AlphaFold

Q8CBC6

Predicted Effect

probably damaging
Transcript: ENSMUST00000043884
AA Change: N126I

PolyPhen 2 Score 1.000 (Sensitivity: 0.00; Specificity: 1.00)

SMART Domains

Protein: ENSMUSP00000043818
Gene: ENSMUSG00000036295
AA Change: N126I

Domain	Start	End	E-Value	Type
signal peptide	1	22	N/A	INTRINSIC
LRRNT	28	73	9.17e-4	SMART
LRR	115	138	2.63e0	SMART
LRR_TYP	139	162	1.5e-4	SMART
LRR	163	186	7.55e-1	SMART
LRR	187	210	1.76e1	SMART
LRR	211	234	1.62e1	SMART
LRR	235	258	5.11e0	SMART
LRR	260	282	3.18e1	SMART
LRR	333	356	4.44e0	SMART
LRRCT	368	420	3.7e-5	SMART
IGc2	435	503	5.04e-9	SMART
FN3	521	602	3.49e0	SMART
transmembrane domain	626	648	N/A	INTRINSIC

Predicted Effect

probably benign
Transcript: ENSMUST00000132121

SMART Domains

Protein: ENSMUSP00000118779
Gene: ENSMUSG00000056899

Domain	Start	End	E-Value	Type
Pfam:Peptidase_S24	38	115	7.7e-11	PFAM

Predicted Effect

probably benign
Transcript: ENSMUST00000134965

SMART Domains

Protein: ENSMUSP00000116441
Gene: ENSMUSG00000056899

Domain	Start	End	E-Value	Type
Pfam:Peptidase_S24	38	114	6.4e-11	PFAM

Meta Mutation Damage Score

0.8268

Coding Region Coverage

1x: 99.1%
3x: 98.4%
10x: 96.6%
20x: 93.6%

Validation Efficiency

96% (64/67)

MGI Phenotype

PHENOTYPE: Homozygous null mutant mice exhibited increased mean percent body fat and male homozygous mutant mice exhibited enhanced glucose tolerance when compared with controls. [provided by MGI curators]

Allele List at MGI

Other mutations in this stock

Total: 58 list
Gene	Ref	Var	Chr/Loc	Mutation	Predicted Effect	Zygosity
1700016H13Rik	A	T	5: 103,649,490	V51E	probably benign	Het
4922502D21Rik	T	C	6: 129,326,850		probably benign	Het
Abo	T	C	2: 26,843,416	Y259C	probably damaging	Het
Adamts5	A	G	16: 85,877,906	S457P	probably damaging	Het
Alk	G	T	17: 71,899,286		probably benign	Het
Alpk2	A	G	18: 65,306,159	I1188T	probably benign	Het
Ambra1	T	C	2: 91,875,739	S730P	possibly damaging	Het
Arhgef2	T	C	3: 88,632,268		probably benign	Het
B3gnt7	T	C	1: 86,305,629	I82T	probably damaging	Het
B4galnt3	T	C	6: 120,216,565	D400G	probably benign	Het
Bag4	A	G	8: 25,767,997	V434A	possibly damaging	Het
BC055324	T	C	1: 163,968,321	I434V	probably benign	Het
Cfc1	A	G	1: 34,537,328	D130G	probably damaging	Het
Chd4	T	C	6: 125,107,480	Y692H	probably damaging	Het
Cilp2	A	G	8: 69,882,993	S452P	probably benign	Het
Crybg2	GAGAAGAAG	GAGAAG	4: 134,072,636		probably benign	Het
Dnah2	T	C	11: 69,499,238	D727G	probably benign	Het
Dock10	C	A	1: 80,535,933	V1129F	possibly damaging	Het
Dsc1	A	T	18: 20,088,354	I688N	possibly damaging	Het
Dyrk1a	C	G	16: 94,663,842	T103R	probably damaging	Het
Ebf1	C	T	11: 44,924,470	R304*	probably null	Het
Eif2s2	A	G	2: 154,884,461		probably benign	Het
Endov	T	G	11: 119,499,571	Y8*	probably null	Het
Eps15	T	A	4: 109,366,480	D485E	probably damaging	Het
Fam118a	C	A	15: 85,045,689	S39R	probably damaging	Het
Fam173b	T	A	15: 31,617,002	Y126*	probably null	Het
Fbxo22	T	A	9: 55,223,626	M393K	possibly damaging	Het
Gab1	A	G	8: 80,800,289	I60T	probably damaging	Het
Gapvd1	A	G	2: 34,693,427	L1059P	probably benign	Het
Gbp5	A	G	3: 142,507,913		probably null	Het
Glb1l2	T	A	9: 26,765,104	K487*	probably null	Het
Hist1h1a	A	G	13: 23,764,158		probably benign	Het
Hmcn1	T	C	1: 150,715,822	I1875M	possibly damaging	Het
Jkamp	T	C	12: 72,094,145		probably null	Het
Kprp	C	T	3: 92,825,713	C10Y	probably damaging	Het
Lrig2	A	G	3: 104,494,056		probably null	Het
Mug1	T	C	6: 121,856,554	F325L	probably benign	Het
Myadm	AC	ACC	7: 3,296,760		probably null	Het
Nagk	C	T	6: 83,797,267	R87*	probably null	Het
Nipal4	T	A	11: 46,161,908	I77F	probably damaging	Het
Olfr1217	A	G	2: 89,023,146	Y286H	probably damaging	Het
Osbp2	T	C	11: 3,819,932	H250R	probably damaging	Het
Pcx	T	C	19: 4,607,642	V378A	possibly damaging	Het
Pfkp	T	A	13: 6,593,210	H524L	probably benign	Het
Picalm	A	T	7: 90,189,198	N370I	possibly damaging	Het
Plcl2	A	C	17: 50,607,955	D664A	possibly damaging	Het
Ptpn5	G	A	7: 47,083,136	P320S	probably benign	Het
Scn3a	T	A	2: 65,525,982		probably benign	Het
Sfswap	A	G	5: 129,504,051	D96G	possibly damaging	Het
Slfn1	A	G	11: 83,121,270	I71V	probably benign	Het
Spata1	A	G	3: 146,476,188		probably null	Het
Stx18	T	C	5: 38,105,005		probably benign	Het
Suox	T	A	10: 128,671,457	H234L	probably benign	Het
Tbc1d17	T	C	7: 44,846,059	S114G	probably benign	Het
Tfeb	T	A	17: 47,788,299		probably null	Het
Tnks	A	C	8: 34,853,309	V736G	probably damaging	Het
Wdhd1	T	C	14: 47,276,588	T4A	probably benign	Het
Wdr66	A	G	5: 123,287,413		probably null	Het

Other mutations in Lrrn3

Allele	Source	Chr	Coord	Type	Predicted Effect	PPH Score
IGL00434:Lrrn3	APN	12	41452192	intron	probably benign
IGL02825:Lrrn3	APN	12	41452593	missense	probably damaging	1.00
IGL02927:Lrrn3	APN	12	41453344	missense	probably damaging	1.00
IGL02970:Lrrn3	APN	12	41452360	missense	probably benign
IGL02995:Lrrn3	APN	12	41452217	missense	probably damaging	1.00
IGL02999:Lrrn3	APN	12	41452751	missense	probably benign	0.01
IGL03182:Lrrn3	APN	12	41454021	missense	probably damaging	1.00
IGL03280:Lrrn3	APN	12	41454147	missense	probably damaging	0.97
PIT4469001:Lrrn3	UTSW	12	41453018	missense	probably benign	0.03
R0167:Lrrn3	UTSW	12	41454015	missense	probably damaging	1.00
R0787:Lrrn3	UTSW	12	41454231	missense	probably damaging	1.00
R0894:Lrrn3	UTSW	12	41454034	missense	probably damaging	1.00
R1433:Lrrn3	UTSW	12	41452584	missense	possibly damaging	0.74
R1610:Lrrn3	UTSW	12	41452993	missense	possibly damaging	0.89
R1834:Lrrn3	UTSW	12	41453518	missense	probably damaging	1.00
R2068:Lrrn3	UTSW	12	41452996	missense	probably damaging	1.00
R2871:Lrrn3	UTSW	12	41452723	missense	probably benign	0.00
R2871:Lrrn3	UTSW	12	41452723	missense	probably benign	0.00
R3771:Lrrn3	UTSW	12	41452870	missense	probably damaging	1.00
R4408:Lrrn3	UTSW	12	41454042	missense	probably benign	0.04
R4410:Lrrn3	UTSW	12	41452584	missense	possibly damaging	0.74
R4684:Lrrn3	UTSW	12	41454244	missense	possibly damaging	0.75
R4770:Lrrn3	UTSW	12	41452443	missense	probably benign	0.08
R4927:Lrrn3	UTSW	12	41453125	missense	probably damaging	1.00
R5037:Lrrn3	UTSW	12	41453595	missense	probably damaging	1.00
R5482:Lrrn3	UTSW	12	41452387	missense	probably benign	0.01
R5482:Lrrn3	UTSW	12	41452388	missense	probably damaging	0.96
R5667:Lrrn3	UTSW	12	41452298	missense	possibly damaging	0.77
R6022:Lrrn3	UTSW	12	41453430	missense	probably damaging	0.96
R6087:Lrrn3	UTSW	12	41453535	missense	possibly damaging	0.84
R6129:Lrrn3	UTSW	12	41453788	nonsense	probably null
R6309:Lrrn3	UTSW	12	41453206	missense	probably damaging	1.00
R7449:Lrrn3	UTSW	12	41453488	missense	probably damaging	1.00
R7555:Lrrn3	UTSW	12	41452911	missense	probably benign	0.01
R7560:Lrrn3	UTSW	12	41452713	missense	possibly damaging	0.93
R8059:Lrrn3	UTSW	12	41454217	missense	probably benign	0.22
R8134:Lrrn3	UTSW	12	41453048	missense	probably damaging	1.00
R8798:Lrrn3	UTSW	12	41453175	missense	possibly damaging	0.61
R9308:Lrrn3	UTSW	12	41453946	missense	probably damaging	1.00
R9318:Lrrn3	UTSW	12	41453244	missense	probably damaging	1.00

Predicted Primers

PCR Primer
(F):5'- TAACCAGGCTGCGAAGCTTGAC -3'
(R):5'- TGCCGACACACAGATTCTGCTC -3'

Sequencing Primer
(F):5'- GAAAGTTCATGTCCTTGATCCTG -3'
(R):5'- AGATTCTGCTCCTACAGACTAAC -3'

Posted On

2013-05-23