Mutagenetix > Incidental Mutations

Incidental Mutation 'R4715:Ubash3b'

401823

Institutional Source

Beutler Lab

Gene Symbol

Ubash3b

Ensembl Gene

ENSMUSG00000032020

Gene Name

ubiquitin associated and SH3 domain containing, B

Synonyms

2810457I06Rik, TULA-2

MMRRC Submission

041982-MU

Accession Numbers

Is this an essential gene?

Probably non essential (E-score: 0.250) question?

Stock #

R4715 (G1)

Quality Score

225

Status

Validated

Chromosome

Chromosomal Location

41011098-41161697 bp(-) (GRCm38)

Type of Mutation

missense

DNA Base Change (assembly)

T to C at 41016600 bp

Zygosity

Heterozygous

Amino Acid Change

Lysine to Glutamic Acid at position 471 (K471E)

Ref Sequence

ENSEMBL: ENSMUSP00000116038 (fasta)

Gene Model

predicted gene model for transcript(s): [ENSMUST00000044155] [ENSMUST00000151485]

Predicted Effect

probably damaging
Transcript: ENSMUST00000044155
AA Change: K593E

PolyPhen 2 Score 0.999 (Sensitivity: 0.14; Specificity: 0.99)

SMART Domains

Protein: ENSMUSP00000043865
Gene: ENSMUSG00000032020
AA Change: K593E

Domain	Start	End	E-Value	Type
UBA	26	64	2.43e-4	SMART
low complexity region	177	186	N/A	INTRINSIC
SH3	246	307	7.29e-10	SMART
Pfam:His_Phos_1	415	598	3e-19	PFAM

Predicted Effect

probably damaging
Transcript: ENSMUST00000151485
AA Change: K471E

PolyPhen 2 Score 0.999 (Sensitivity: 0.14; Specificity: 0.99)

SMART Domains

Protein: ENSMUSP00000116038
Gene: ENSMUSG00000032020
AA Change: K471E

Domain	Start	End	E-Value	Type
low complexity region	55	64	N/A	INTRINSIC
SH3	124	185	7.29e-10	SMART
Pfam:His_Phos_1	252	450	1.9e-27	PFAM

Meta Mutation Damage Score

0.2055

Coding Region Coverage

1x: 99.2%
3x: 98.6%
10x: 97.2%
20x: 95.0%

Validation Efficiency

92% (86/93)

MGI Phenotype

FUNCTION: [Summary is not available for the mouse gene. This summary is for the human ortholog.] This gene encodes a protein that contains a ubiquitin associated domain at the N-terminus, an SH3 domain, and a C-terminal domain with similarities to the catalytic motif of phosphoglycerate mutase. The encoded protein was found to inhibit endocytosis of epidermal growth factor receptor (EGFR) and platelet-derived growth factor receptor. [provided by RefSeq, Jul 2008]
PHENOTYPE: Mice homozygous for a knock-out allele are viable, fertile, developmentally normal, and do not display any obvious phenotypic abnormalities. [provided by MGI curators]

Allele List at MGI

Other mutations in this stock

Total: 80 list
Gene	Ref	Var	Chr/Loc	Mutation	Predicted Effect	Zygosity
Abcc2	A	C	19: 43,816,882	E725A	possibly damaging	Het
Abcc5	G	T	16: 20,398,876	L362I	probably damaging	Het
Ammecr1l	C	T	18: 31,774,653	R179*	probably null	Het
Arap2	G	T	5: 62,749,094	T194K	probably benign	Het
Atf2	C	A	2: 73,823,300	V282F	probably damaging	Het
Atp1a1	T	C	3: 101,591,806	E159G	possibly damaging	Het
B4galt2	T	C	4: 117,877,179	S258G	possibly damaging	Het
Bptf	G	T	11: 107,047,181	H2695N	probably damaging	Het
Casq2	T	C	3: 102,110,244	V80A	probably benign	Het
Ccdc130	A	G	8: 84,263,874	I43T	probably damaging	Het
Cdc42ep3	G	A	17: 79,335,458	A11V	probably benign	Het
Cdh4	A	T	2: 179,780,467	H128L	probably benign	Het
Cdk5rap1	C	A	2: 154,361,835	*191L	probably null	Het
Cfdp1	G	A	8: 111,830,891	T206I	probably benign	Het
Cgn	C	A	3: 94,779,438	G185W	probably damaging	Het
Clpx	A	C	9: 65,312,114	R231S	possibly damaging	Het
Copg1	T	A	6: 87,912,286	L870*	probably null	Het
Cyp4a10	A	T	4: 115,525,338	D275V	probably benign	Het
Dip2a	T	C	10: 76,296,406	T504A	probably benign	Het
Dmxl2	A	C	9: 54,446,405		probably null	Het
Dnaaf5	A	T	5: 139,178,000	I671F	probably damaging	Het
Dnah14	A	G	1: 181,757,223	D3173G	probably damaging	Het
Dock2	T	C	11: 34,294,118	Y1074C	probably damaging	Het
Dthd1	A	C	5: 62,888,187	M765L	probably benign	Het
E2f3	A	C	13: 29,911,275	C220W	probably damaging	Het
Elf3	C	T	1: 135,257,752	S8N	probably damaging	Het
F2rl1	A	T	13: 95,513,267	V369E	probably damaging	Het
Fam214a	T	A	9: 75,012,968	W799R	probably damaging	Het
Fpr-rs7	C	T	17: 20,113,428	G267R	probably benign	Het
Ggact	A	T	14: 122,891,635	L56Q	possibly damaging	Het
Gm10698	A	T	9: 33,728,488		noncoding transcript	Het
Gm5546	T	C	3: 104,366,508		noncoding transcript	Het
Gm8267	A	G	14: 44,717,835	V243A	probably benign	Het
Gtf2h1	A	G	7: 46,815,412	T424A	possibly damaging	Het
Gucy1b2	A	G	14: 62,423,017	V140A	possibly damaging	Het
Htatip2	T	C	7: 49,770,844	L146P	probably damaging	Het
Htr1b	T	C	9: 81,631,510	D348G	possibly damaging	Het
Ifi205	T	C	1: 174,028,321	I48V	possibly damaging	Het
Igkv18-36	C	T	6: 69,992,591	R72K	probably damaging	Het
Kcnk7	T	C	19: 5,706,253	L169P	probably damaging	Het
Klf17	T	C	4: 117,760,536	D208G	probably benign	Het
Ltn1	A	G	16: 87,418,494	F418L	probably damaging	Het
Map4k4	G	A	1: 40,019,564	V1040I	probably damaging	Het
Mark1	A	G	1: 184,912,132	V445A	probably benign	Het
Med11	T	C	11: 70,453,196	I114T	probably benign	Het
Moxd2	A	G	6: 40,887,247	V83A	probably damaging	Het
Mrpl33	A	G	5: 31,616,358		probably benign	Het
Mrps27	A	G	13: 99,414,815		probably null	Het
Nop58	T	C	1: 59,696,026	V75A	probably benign	Het
Olfr1290	A	C	2: 111,489,744	M138R	probably benign	Het
Olfr1339	T	C	4: 118,734,655	L42P	probably damaging	Het
Olfr136	A	C	17: 38,335,840	I228L	possibly damaging	Het
Olfr325	A	G	11: 58,581,429	D195G	probably damaging	Het
Olfr832	A	G	9: 18,945,446	H266R	probably benign	Het
Olfr844	C	A	9: 19,319,147	F210L	probably benign	Het
Pdzd2	G	T	15: 12,419,516	N263K	possibly damaging	Het
Podnl1	C	A	8: 84,126,061		probably benign	Het
Prkd3	G	T	17: 78,951,937	H864N	possibly damaging	Het
Ptprd	T	C	4: 76,107,333	T543A	probably benign	Het
Pum2	T	A	12: 8,747,272	I788N	probably damaging	Het
Ralgapa1	T	A	12: 55,693,458	N1328I	probably damaging	Het
Rhoc	T	C	3: 104,794,039	L193P	probably damaging	Het
Rif1	T	C	2: 52,073,139		probably benign	Het
Rspo2	A	T	15: 43,075,904	C163*	probably null	Het
Sco1	A	G	11: 67,056,599	Y204C	probably damaging	Het
Shc2	T	C	10: 79,622,379	K490R	probably benign	Het
Siglec1	T	C	2: 131,074,436	D1198G	probably damaging	Het
Slc25a18	T	C	6: 120,786,090	V31A	probably damaging	Het
Smpd5	A	T	15: 76,295,693	I112L	probably benign	Het
Synpr	CT	C	14: 13,285,198		probably null	Het
Tdrd9	T	G	12: 112,041,689	S988A	probably benign	Het
Tiam2	T	A	17: 3,454,168	F982I	probably damaging	Het
Tmc3	G	A	7: 83,622,396	V919I	probably benign	Het
Tmem200c	A	T	17: 68,840,470	D16V	probably damaging	Het
Tmem37	A	T	1: 120,068,205	D47E	probably damaging	Het
Top3a	T	A	11: 60,742,997	R733*	probably null	Het
Treh	T	C	9: 44,683,318	V8A	probably benign	Het
Trim17	A	C	11: 58,968,450		probably benign	Het
Usp8	T	A	2: 126,729,222	L144Q	possibly damaging	Het
Wnk2	T	A	13: 49,147,232	M1L	unknown	Het

Other mutations in Ubash3b

Allele	Source	Chr	Coord	Type	Predicted Effect	PPH Score
IGL01364:Ubash3b	APN	9	41018015	critical splice donor site	probably null
IGL01734:Ubash3b	APN	9	41026247	splice site	probably benign
IGL02311:Ubash3b	APN	9	41047037	missense	probably benign
IGL03406:Ubash3b	APN	9	41037479	missense	probably damaging	1.00
PIT4618001:Ubash3b	UTSW	9	41016627	missense	probably benign	0.00
PIT4687001:Ubash3b	UTSW	9	41023518	missense	probably damaging	1.00
R0524:Ubash3b	UTSW	9	41016608	missense	probably benign	0.16
R0666:Ubash3b	UTSW	9	41047064	missense	possibly damaging	0.67
R0927:Ubash3b	UTSW	9	41023557	nonsense	probably null
R1112:Ubash3b	UTSW	9	41028116	missense	probably damaging	1.00
R1544:Ubash3b	UTSW	9	41016605	missense	probably damaging	1.00
R1596:Ubash3b	UTSW	9	41031497	missense	probably benign
R1610:Ubash3b	UTSW	9	41043500	missense	probably damaging	1.00
R2069:Ubash3b	UTSW	9	41043573	missense	possibly damaging	0.82
R2507:Ubash3b	UTSW	9	41157354	missense	possibly damaging	0.90
R2520:Ubash3b	UTSW	9	41014947	missense	probably damaging	1.00
R3899:Ubash3b	UTSW	9	41031564	missense	probably benign	0.00
R3900:Ubash3b	UTSW	9	41031564	missense	probably benign	0.00
R4876:Ubash3b	UTSW	9	41018109	missense	probably benign	0.00
R5023:Ubash3b	UTSW	9	41037459	missense	possibly damaging	0.90
R5034:Ubash3b	UTSW	9	41029740	missense	probably benign	0.25
R5057:Ubash3b	UTSW	9	41037459	missense	possibly damaging	0.90
R5396:Ubash3b	UTSW	9	41043473	critical splice donor site	probably null
R5448:Ubash3b	UTSW	9	41037435	critical splice donor site	probably null
R5760:Ubash3b	UTSW	9	41077423	missense	probably benign	0.00
R6178:Ubash3b	UTSW	9	41014916	missense	probably damaging	0.96
R6392:Ubash3b	UTSW	9	41014972	missense	probably damaging	1.00
R8115:Ubash3b	UTSW	9	41026328	missense	probably damaging	1.00
R8406:Ubash3b	UTSW	9	41029675	missense	probably damaging	1.00
R8411:Ubash3b	UTSW	9	41043485	missense	probably benign	0.02

Predicted Primers

PCR Primer
(F):5'- TACCCTACGAAGCTCCACTG -3'
(R):5'- GTAGATTCTCCTGCCCTACATTGAC -3'

Sequencing Primer
(F):5'- CACTGAACACATCTTGGCTGAGTTG -3'
(R):5'- GTTGCAGTGTCCAGGACCAAAC -3'

Posted On

2016-07-08