Mutagenetix > Incidental Mutations

Incidental Mutation 'R0414:Wdhd1'

40186

Institutional Source

Beutler Lab

Gene Symbol

Wdhd1

Ensembl Gene

ENSMUSG00000037572

Gene Name

WD repeat and HMG-box DNA binding protein 1

Synonyms

AND-1, D630024B06Rik

MMRRC Submission

038616-MU

Accession Numbers

Is this an essential gene?

Essential (E-score: 1.000) question?

Stock #

R0414 (G1)

Quality Score

225

Status

Validated

Chromosome

Chromosomal Location

47240944-47276857 bp(-) (GRCm38)

Type of Mutation

missense

DNA Base Change (assembly)

T to C at 47276588 bp

Zygosity

Heterozygous

Amino Acid Change

Threonine to Alanine at position 4 (T4A)

Ref Sequence

ENSEMBL: ENSMUSP00000141182 (fasta)

Gene Model

predicted gene model for transcript(s): [ENSMUST00000065562] [ENSMUST00000111790] [ENSMUST00000111791] [ENSMUST00000111792] [ENSMUST00000187531] [ENSMUST00000227413]

Predicted Effect

probably benign
Transcript: ENSMUST00000065562

SMART Domains

Protein: ENSMUSP00000066031
Gene: ENSMUSG00000048379

Domain	Start	End	E-Value	Type
low complexity region	30	47	N/A	INTRINSIC
Pfam:SOCS	55	108	6.8e-23	PFAM
low complexity region	219	232	N/A	INTRINSIC
SH2	281	367	1.11e-16	SMART
SOCS	377	420	1.69e-16	SMART
SOCS_box	383	419	1.13e-9	SMART

Predicted Effect

probably benign
Transcript: ENSMUST00000111790
AA Change: T4A

PolyPhen 2 Score 0.000 (Sensitivity: 1.00; Specificity: 0.00)

SMART Domains

Protein: ENSMUSP00000107420
Gene: ENSMUSG00000037572
AA Change: T4A

Domain	Start	End	E-Value	Type
WD40	4	41	8.62e-4	SMART
WD40	83	122	8.91e-1	SMART
WD40	125	164	1.67e-10	SMART
WD40	217	258	6.19e-1	SMART
WD40	261	301	5.11e1	SMART
low complexity region	353	363	N/A	INTRINSIC
Pfam:DUF3639	525	551	2.4e-13	PFAM

Predicted Effect

probably benign
Transcript: ENSMUST00000111791
AA Change: T4A

PolyPhen 2 Score 0.000 (Sensitivity: 1.00; Specificity: 0.00)

SMART Domains

Protein: ENSMUSP00000107421
Gene: ENSMUSG00000037572
AA Change: T4A

Domain	Start	End	E-Value	Type
WD40	4	41	8.62e-4	SMART
WD40	83	122	8.91e-1	SMART
WD40	125	164	1.67e-10	SMART
WD40	217	258	6.19e-1	SMART
WD40	261	301	5.11e1	SMART
low complexity region	353	363	N/A	INTRINSIC
Pfam:Mcl1_mid	424	708	1.6e-103	PFAM
coiled coil region	802	834	N/A	INTRINSIC
HMG	1003	1073	2.64e-12	SMART

Predicted Effect

probably benign
Transcript: ENSMUST00000111792
AA Change: T4A

PolyPhen 2 Score 0.000 (Sensitivity: 1.00; Specificity: 0.00)

SMART Domains

Protein: ENSMUSP00000107422
Gene: ENSMUSG00000037572
AA Change: T4A

Domain	Start	End	E-Value	Type
WD40	4	41	8.62e-4	SMART
WD40	83	122	8.91e-1	SMART
WD40	125	164	1.67e-10	SMART
WD40	217	258	6.19e-1	SMART
WD40	261	301	5.11e1	SMART
low complexity region	316	326	N/A	INTRINSIC
Pfam:DUF3639	488	514	7.1e-13	PFAM
coiled coil region	765	797	N/A	INTRINSIC
HMG	966	1036	2.64e-12	SMART

Predicted Effect

noncoding transcript
Transcript: ENSMUST00000139124

Predicted Effect

probably benign
Transcript: ENSMUST00000187531
AA Change: T4A

PolyPhen 2 Score 0.000 (Sensitivity: 1.00; Specificity: 0.00)

SMART Domains

Protein: ENSMUSP00000141182
Gene: ENSMUSG00000037572
AA Change: T4A

Domain	Start	End	E-Value	Type
WD40	4	41	8.62e-4	SMART
WD40	83	122	8.91e-1	SMART
WD40	125	164	1.67e-10	SMART
WD40	217	258	6.19e-1	SMART
WD40	261	301	5.11e1	SMART
low complexity region	353	363	N/A	INTRINSIC
Pfam:DUF3639	525	551	3e-13	PFAM
coiled coil region	802	834	N/A	INTRINSIC
HMG	1003	1073	2.64e-12	SMART

Predicted Effect

probably benign
Transcript: ENSMUST00000227413

Predicted Effect

noncoding transcript
Transcript: ENSMUST00000228623

Meta Mutation Damage Score

0.0931

Coding Region Coverage

1x: 99.1%
3x: 98.4%
10x: 96.6%
20x: 93.6%

Validation Efficiency

96% (64/67)

MGI Phenotype

FUNCTION: [Summary is not available for the mouse gene. This summary is for the human ortholog.] The protein encoded by this gene contains multiple N-terminal WD40 domains and a C-terminal high mobility group (HMG) box. WD40 domains are found in a variety of eukaryotic proteins and may function as adaptor/regulatory modules in signal transduction, pre-mRNA processing and cytoskeleton assembly. HMG boxes are found in many eukaryotic proteins involved in chromatin assembly, transcription and replication. Alternative splicing results in two transcript variants encoding different isoforms. [provided by RefSeq, Jul 2008]

Allele List at MGI

Other mutations in this stock

Total: 58 list
Gene	Ref	Var	Chr/Loc	Mutation	Predicted Effect	Zygosity
1700016H13Rik	A	T	5: 103,649,490	V51E	probably benign	Het
4922502D21Rik	T	C	6: 129,326,850		probably benign	Het
Abo	T	C	2: 26,843,416	Y259C	probably damaging	Het
Adamts5	A	G	16: 85,877,906	S457P	probably damaging	Het
Alk	G	T	17: 71,899,286		probably benign	Het
Alpk2	A	G	18: 65,306,159	I1188T	probably benign	Het
Ambra1	T	C	2: 91,875,739	S730P	possibly damaging	Het
Arhgef2	T	C	3: 88,632,268		probably benign	Het
B3gnt7	T	C	1: 86,305,629	I82T	probably damaging	Het
B4galnt3	T	C	6: 120,216,565	D400G	probably benign	Het
Bag4	A	G	8: 25,767,997	V434A	possibly damaging	Het
BC055324	T	C	1: 163,968,321	I434V	probably benign	Het
Cfc1	A	G	1: 34,537,328	D130G	probably damaging	Het
Chd4	T	C	6: 125,107,480	Y692H	probably damaging	Het
Cilp2	A	G	8: 69,882,993	S452P	probably benign	Het
Crybg2	GAGAAGAAG	GAGAAG	4: 134,072,636		probably benign	Het
Dnah2	T	C	11: 69,499,238	D727G	probably benign	Het
Dock10	C	A	1: 80,535,933	V1129F	possibly damaging	Het
Dsc1	A	T	18: 20,088,354	I688N	possibly damaging	Het
Dyrk1a	C	G	16: 94,663,842	T103R	probably damaging	Het
Ebf1	C	T	11: 44,924,470	R304*	probably null	Het
Eif2s2	A	G	2: 154,884,461		probably benign	Het
Endov	T	G	11: 119,499,571	Y8*	probably null	Het
Eps15	T	A	4: 109,366,480	D485E	probably damaging	Het
Fam118a	C	A	15: 85,045,689	S39R	probably damaging	Het
Fam173b	T	A	15: 31,617,002	Y126*	probably null	Het
Fbxo22	T	A	9: 55,223,626	M393K	possibly damaging	Het
Gab1	A	G	8: 80,800,289	I60T	probably damaging	Het
Gapvd1	A	G	2: 34,693,427	L1059P	probably benign	Het
Gbp5	A	G	3: 142,507,913		probably null	Het
Glb1l2	T	A	9: 26,765,104	K487*	probably null	Het
Hist1h1a	A	G	13: 23,764,158		probably benign	Het
Hmcn1	T	C	1: 150,715,822	I1875M	possibly damaging	Het
Jkamp	T	C	12: 72,094,145		probably null	Het
Kprp	C	T	3: 92,825,713	C10Y	probably damaging	Het
Lrig2	A	G	3: 104,494,056		probably null	Het
Lrrn3	T	A	12: 41,453,940	N126I	probably damaging	Het
Mug1	T	C	6: 121,856,554	F325L	probably benign	Het
Myadm	AC	ACC	7: 3,296,760		probably null	Het
Nagk	C	T	6: 83,797,267	R87*	probably null	Het
Nipal4	T	A	11: 46,161,908	I77F	probably damaging	Het
Olfr1217	A	G	2: 89,023,146	Y286H	probably damaging	Het
Osbp2	T	C	11: 3,819,932	H250R	probably damaging	Het
Pcx	T	C	19: 4,607,642	V378A	possibly damaging	Het
Pfkp	T	A	13: 6,593,210	H524L	probably benign	Het
Picalm	A	T	7: 90,189,198	N370I	possibly damaging	Het
Plcl2	A	C	17: 50,607,955	D664A	possibly damaging	Het
Ptpn5	G	A	7: 47,083,136	P320S	probably benign	Het
Scn3a	T	A	2: 65,525,982		probably benign	Het
Sfswap	A	G	5: 129,504,051	D96G	possibly damaging	Het
Slfn1	A	G	11: 83,121,270	I71V	probably benign	Het
Spata1	A	G	3: 146,476,188		probably null	Het
Stx18	T	C	5: 38,105,005		probably benign	Het
Suox	T	A	10: 128,671,457	H234L	probably benign	Het
Tbc1d17	T	C	7: 44,846,059	S114G	probably benign	Het
Tfeb	T	A	17: 47,788,299		probably null	Het
Tnks	A	C	8: 34,853,309	V736G	probably damaging	Het
Wdr66	A	G	5: 123,287,413		probably null	Het

Other mutations in Wdhd1

Allele	Source	Chr	Coord	Type	Predicted Effect	PPH Score
IGL01335:Wdhd1	APN	14	47250782	missense	possibly damaging	0.87
IGL01789:Wdhd1	APN	14	47274817	missense	probably benign	0.10
IGL01981:Wdhd1	APN	14	47261450	missense	probably damaging	1.00
IGL02034:Wdhd1	APN	14	47261351	missense	probably benign	0.02
IGL02932:Wdhd1	APN	14	47272134	critical splice donor site	probably null
IGL02966:Wdhd1	APN	14	47241644	missense	possibly damaging	0.93
IGL03355:Wdhd1	APN	14	47243889	missense	possibly damaging	0.78
R0165:Wdhd1	UTSW	14	47267068	missense	probably benign	0.00
R0603:Wdhd1	UTSW	14	47263586	missense	probably damaging	1.00
R1503:Wdhd1	UTSW	14	47247400	missense	probably benign	0.00
R1539:Wdhd1	UTSW	14	47245050	missense	possibly damaging	0.63
R1541:Wdhd1	UTSW	14	47268192	nonsense	probably null
R1588:Wdhd1	UTSW	14	47256236	missense	probably damaging	1.00
R1686:Wdhd1	UTSW	14	47256215	missense	probably damaging	1.00
R1916:Wdhd1	UTSW	14	47258577	missense	possibly damaging	0.89
R1952:Wdhd1	UTSW	14	47270190	missense	probably damaging	1.00
R2320:Wdhd1	UTSW	14	47274028	missense	probably benign	0.06
R2421:Wdhd1	UTSW	14	47258584	missense	probably benign	0.00
R3731:Wdhd1	UTSW	14	47247892	missense	possibly damaging	0.89
R3818:Wdhd1	UTSW	14	47243801	critical splice donor site	probably null
R3836:Wdhd1	UTSW	14	47245054	missense	probably benign	0.01
R4789:Wdhd1	UTSW	14	47268692	missense	probably benign	0.01
R4963:Wdhd1	UTSW	14	47268689	missense	possibly damaging	0.66
R4994:Wdhd1	UTSW	14	47268654	critical splice donor site	probably null
R5225:Wdhd1	UTSW	14	47250816	missense	probably benign	0.01
R5347:Wdhd1	UTSW	14	47268724	nonsense	probably null
R5377:Wdhd1	UTSW	14	47272221	missense	probably benign	0.15
R6038:Wdhd1	UTSW	14	47263580	missense	possibly damaging	0.89
R6038:Wdhd1	UTSW	14	47263580	missense	possibly damaging	0.89
R6046:Wdhd1	UTSW	14	47273210	nonsense	probably null
R6156:Wdhd1	UTSW	14	47268196	missense	probably damaging	0.99
R6289:Wdhd1	UTSW	14	47258496	missense	possibly damaging	0.95
R6298:Wdhd1	UTSW	14	47273122	missense	possibly damaging	0.67
R6345:Wdhd1	UTSW	14	47251922	missense	probably damaging	0.99
R6405:Wdhd1	UTSW	14	47243867	missense	possibly damaging	0.91
R6500:Wdhd1	UTSW	14	47250760	splice site	probably null
R6564:Wdhd1	UTSW	14	47248042	missense	probably benign
R6897:Wdhd1	UTSW	14	47248130	missense	probably damaging	1.00
R7262:Wdhd1	UTSW	14	47251973	missense	probably benign	0.08
R7444:Wdhd1	UTSW	14	47251948	nonsense	probably null
R7496:Wdhd1	UTSW	14	47274024	missense	probably benign	0.39
R7503:Wdhd1	UTSW	14	47250791	missense	probably benign	0.25

Predicted Primers

PCR Primer
(F):5'- GTCCTAGAAGTGCCACGACAGTTC -3'
(R):5'- TGCTTGCAGAGGGGAAAGCTTG -3'

Sequencing Primer
(F):5'- GTGCCACGACAGTTCAAAGC -3'
(R):5'- GGAAAGCTTGTCATCTCCCG -3'

Posted On

2013-05-23