Incidental Mutation 'R4737:Muc6'
ID 401870
Institutional Source Beutler Lab
Gene Symbol Muc6
Ensembl Gene ENSMUSG00000048191
Gene Name mucin 6, gastric
Synonyms
MMRRC Submission 042024-MU
Accession Numbers
Essential gene? Probably non essential (E-score: 0.095) question?
Stock # R4737 (G1)
Quality Score 26
Status Validated
Chromosome 7
Chromosomal Location 141213373-141241641 bp(-) (GRCm39)
Type of Mutation missense
DNA Base Change (assembly) G to T at 141218685 bp (GRCm39)
Zygosity Heterozygous
Amino Acid Change Threonine to Asparagine at position 1996 (T1996N)
Ref Sequence ENSEMBL: ENSMUSP00000140483 (fasta)
Gene Model predicted gene model for transcript(s): [ENSMUST00000062451] [ENSMUST00000189314] [ENSMUST00000190907]
AlphaFold no structure available at present
Predicted Effect possibly damaging
Transcript: ENSMUST00000062451
AA Change: T1931N

PolyPhen 2 Score 0.613 (Sensitivity: 0.87; Specificity: 0.91)
SMART Domains Protein: ENSMUSP00000049941
Gene: ENSMUSG00000048191
AA Change: T1931N

DomainStartEndE-ValueType
signal peptide 1 22 N/A INTRINSIC
VWD 29 234 2.49e-14 SMART
C8 267 340 5.46e-3 SMART
Pfam:TIL 344 399 5.6e-14 PFAM
VWC 401 469 2.57e-7 SMART
VWD 428 591 4.81e-30 SMART
C8 627 703 8.84e-21 SMART
SCOP:d1coua_ 706 769 7e-9 SMART
Pfam:TIL 806 869 1.9e-9 PFAM
VWC 871 941 8.52e-3 SMART
VWD 898 1060 1.59e-30 SMART
C8 1096 1170 5.52e-31 SMART
Blast:CT 1184 1236 2e-19 BLAST
low complexity region 1240 1269 N/A INTRINSIC
low complexity region 1275 1293 N/A INTRINSIC
low complexity region 1313 1337 N/A INTRINSIC
low complexity region 1345 1374 N/A INTRINSIC
internal_repeat_3 1375 1560 6.78e-17 PROSPERO
internal_repeat_2 1426 1751 8.94e-34 PROSPERO
low complexity region 1761 1780 N/A INTRINSIC
low complexity region 1867 1887 N/A INTRINSIC
low complexity region 1896 1910 N/A INTRINSIC
low complexity region 1912 1946 N/A INTRINSIC
low complexity region 1990 2004 N/A INTRINSIC
low complexity region 2010 2020 N/A INTRINSIC
internal_repeat_2 2036 2430 8.94e-34 PROSPERO
internal_repeat_3 2329 2516 6.78e-17 PROSPERO
low complexity region 2519 2536 N/A INTRINSIC
low complexity region 2564 2587 N/A INTRINSIC
low complexity region 2605 2630 N/A INTRINSIC
low complexity region 2642 2677 N/A INTRINSIC
low complexity region 2729 2762 N/A INTRINSIC
Blast:CT 2765 2852 1e-44 BLAST
Predicted Effect probably benign
Transcript: ENSMUST00000189314
SMART Domains Protein: ENSMUSP00000140388
Gene: ENSMUSG00000048191

DomainStartEndE-ValueType
signal peptide 1 22 N/A INTRINSIC
VWD 29 193 2.64e-27 SMART
C8 226 299 5.46e-3 SMART
Pfam:TIL 303 358 1.4e-13 PFAM
VWC 360 428 2.57e-7 SMART
VWD 387 550 4.81e-30 SMART
C8 586 662 8.84e-21 SMART
internal_repeat_2 665 754 5.76e-7 PROSPERO
Pfam:TIL 765 828 6.4e-9 PFAM
VWC 830 900 8.52e-3 SMART
VWD 857 1019 1.59e-30 SMART
C8 1055 1129 5.52e-31 SMART
low complexity region 1199 1228 N/A INTRINSIC
low complexity region 1234 1252 N/A INTRINSIC
low complexity region 1272 1296 N/A INTRINSIC
low complexity region 1304 1333 N/A INTRINSIC
Predicted Effect possibly damaging
Transcript: ENSMUST00000190907
AA Change: T1996N

PolyPhen 2 Score 0.719 (Sensitivity: 0.86; Specificity: 0.92)
SMART Domains Protein: ENSMUSP00000140483
Gene: ENSMUSG00000048191
AA Change: T1996N

DomainStartEndE-ValueType
signal peptide 1 22 N/A INTRINSIC
VWD 29 234 1.2e-16 SMART
C8 267 340 4.2e-7 SMART
Pfam:TIL 344 399 7.2e-11 PFAM
VWC_def 401 469 1.2e-9 SMART
VWD 428 591 2.4e-32 SMART
C8 627 703 6.7e-25 SMART
SCOP:d1coua_ 706 769 5e-9 SMART
Pfam:TIL 806 869 3.3e-6 PFAM
VWC_def 871 941 4.1e-5 SMART
VWD 898 1060 7.7e-33 SMART
C8 1096 1170 4.2e-35 SMART
Blast:CT 1184 1236 2e-19 BLAST
low complexity region 1240 1269 N/A INTRINSIC
low complexity region 1275 1293 N/A INTRINSIC
low complexity region 1313 1337 N/A INTRINSIC
low complexity region 1345 1374 N/A INTRINSIC
low complexity region 1406 1419 N/A INTRINSIC
internal_repeat_1 1426 1822 3.44e-48 PROSPERO
low complexity region 1826 1845 N/A INTRINSIC
low complexity region 1932 1952 N/A INTRINSIC
low complexity region 1961 1975 N/A INTRINSIC
low complexity region 1977 2011 N/A INTRINSIC
low complexity region 2055 2069 N/A INTRINSIC
low complexity region 2075 2085 N/A INTRINSIC
internal_repeat_1 2101 2501 3.44e-48 PROSPERO
low complexity region 2504 2524 N/A INTRINSIC
low complexity region 2584 2601 N/A INTRINSIC
low complexity region 2629 2652 N/A INTRINSIC
low complexity region 2670 2695 N/A INTRINSIC
low complexity region 2707 2742 N/A INTRINSIC
low complexity region 2794 2827 N/A INTRINSIC
Blast:CT 2830 2917 1e-44 BLAST
Meta Mutation Damage Score 0.1795 question?
Coding Region Coverage
  • 1x: 99.2%
  • 3x: 98.6%
  • 10x: 97.2%
  • 20x: 95.3%
Validation Efficiency 100% (94/94)
MGI Phenotype FUNCTION: [Summary is not available for the mouse gene. This summary is for the human ortholog.] This gene encodes a member of the mucin protein family. Mucins are high molecular weight glycoproteins produced by many epithelial tissues. The protein encoded by this gene is secreted and forms an insoluble mucous barrier that protects the gut lumen. [provided by RefSeq, Dec 2016]
Allele List at MGI
Other mutations in this stock
Total: 87 list
GeneRefVarChr/LocMutationPredicted EffectZygosity
A430110L20Rik A G 1: 181,055,384 (GRCm39) noncoding transcript Het
Acp2 A T 2: 91,041,068 (GRCm39) R419W probably benign Het
Actr5 A G 2: 158,469,991 (GRCm39) N207S probably damaging Het
Afap1 G A 5: 36,119,126 (GRCm39) V254M probably benign Het
Arfgef1 A T 1: 10,259,836 (GRCm39) M544K possibly damaging Het
Arhgap5 A T 12: 52,565,860 (GRCm39) M944L probably benign Het
Bnip3l-ps G A 12: 18,266,773 (GRCm39) noncoding transcript Het
Carf A G 1: 60,148,477 (GRCm39) T58A probably benign Het
Carns1 A G 19: 4,220,927 (GRCm39) probably benign Het
Ccp110 T A 7: 118,323,771 (GRCm39) I670K possibly damaging Het
Cftr T A 6: 18,299,882 (GRCm39) D1218E probably benign Het
Chrna9 A T 5: 66,125,214 (GRCm39) T52S probably damaging Het
Chst9 T C 18: 15,585,834 (GRCm39) Y243C probably damaging Het
Ciao3 A T 17: 26,000,283 (GRCm39) H322L probably damaging Het
Cilk1 A G 9: 78,057,936 (GRCm39) T162A probably damaging Het
Clk2 A T 3: 89,076,016 (GRCm39) H62L probably benign Het
Cntnap2 A T 6: 45,037,251 (GRCm39) R10W possibly damaging Het
Cpt1b C T 15: 89,305,609 (GRCm39) D369N probably benign Het
Crhr2 G T 6: 55,068,290 (GRCm39) H423Q probably damaging Het
D8Ertd738e T A 8: 84,976,150 (GRCm39) I33F probably damaging Het
Dbt T C 3: 116,332,781 (GRCm39) I200T probably damaging Het
Ddhd1 A T 14: 45,866,278 (GRCm39) probably benign Het
Ddx27 A G 2: 166,871,219 (GRCm39) I480V probably benign Het
Dpp9 A C 17: 56,505,970 (GRCm39) probably null Het
Dpy19l3 A T 7: 35,402,926 (GRCm39) M562K probably damaging Het
Dus3l T C 17: 57,074,868 (GRCm39) L330P probably damaging Het
Efcab7 C T 4: 99,719,805 (GRCm39) Q96* probably null Het
Egfr T C 11: 16,819,231 (GRCm39) F254L probably damaging Het
Eml5 C T 12: 98,765,111 (GRCm39) V1566M probably damaging Het
Entpd7 T A 19: 43,679,634 (GRCm39) Y62* probably null Het
Erbb4 T C 1: 68,383,059 (GRCm39) M313V probably damaging Het
Gm5528 A G 1: 72,043,711 (GRCm39) noncoding transcript Het
H2-M9 G T 17: 36,951,631 (GRCm39) Y281* probably null Het
Hmcn1 T G 1: 150,565,346 (GRCm39) K2260N possibly damaging Het
Hnf4a A G 2: 163,406,139 (GRCm39) I259V probably benign Het
Insm1 A T 2: 146,064,822 (GRCm39) T213S probably benign Het
Iqca1 T C 1: 90,005,544 (GRCm39) D488G probably damaging Het
Kdm5a T A 6: 120,382,976 (GRCm39) probably benign Het
Kdm7a G C 6: 39,129,773 (GRCm39) L468V possibly damaging Het
Lck G A 4: 129,449,777 (GRCm39) T229I possibly damaging Het
Lig3 T C 11: 82,678,553 (GRCm39) L265P probably damaging Het
Lipa T A 19: 34,479,034 (GRCm39) K229* probably null Het
Lrrk1 C T 7: 65,956,621 (GRCm39) S418N probably benign Het
Mark2 A G 19: 7,258,597 (GRCm39) V126A probably damaging Het
Met T C 6: 17,491,540 (GRCm39) C101R probably damaging Het
Mkln1 A T 6: 31,403,734 (GRCm39) K85M probably damaging Het
Mst1 A G 9: 107,957,720 (GRCm39) R15G probably benign Het
Myo7b T C 18: 32,131,655 (GRCm39) S514G probably damaging Het
Nars1 T C 18: 64,649,498 (GRCm39) E11G probably benign Het
Ogdh T A 11: 6,247,044 (GRCm39) F23I probably benign Het
Or10g9 A T 9: 39,911,718 (GRCm39) D268E probably damaging Het
Or12e9 T C 2: 87,202,665 (GRCm39) I263T probably damaging Het
Or4a39 C T 2: 89,236,830 (GRCm39) V198I probably benign Het
Or4b1b A G 2: 90,112,725 (GRCm39) S65P probably damaging Het
Or4c100 C T 2: 88,356,569 (GRCm39) S214F probably damaging Het
Or52r1c C T 7: 102,735,121 (GRCm39) A127V probably damaging Het
Or9k2 T A 10: 129,998,707 (GRCm39) T163S probably benign Het
Otub2 T A 12: 103,359,103 (GRCm39) L64Q probably benign Het
Pappa2 T C 1: 158,784,582 (GRCm39) R143G probably benign Het
Patl2 T A 2: 121,955,787 (GRCm39) T250S probably damaging Het
Pcdhac2 C T 18: 37,278,952 (GRCm39) T644I possibly damaging Het
Pi4kb C T 3: 94,911,649 (GRCm39) T690I probably damaging Het
Pla2g4d T C 2: 120,097,271 (GRCm39) Y776C probably benign Het
Plekhh2 C T 17: 84,871,387 (GRCm39) S215L probably benign Het
Psmd2 T G 16: 20,478,565 (GRCm39) probably benign Het
Ptpn21 T C 12: 98,675,103 (GRCm39) E183G probably benign Het
Ptprg T A 14: 12,226,314 (GRCm38) D527E probably damaging Het
Rhobtb1 T A 10: 69,115,327 (GRCm39) probably null Het
Scel T A 14: 103,809,473 (GRCm39) M271K possibly damaging Het
Senp3 A T 11: 69,569,655 (GRCm39) C310* probably null Het
Slc25a3 T C 10: 90,958,050 (GRCm39) T97A possibly damaging Het
Srsf11 A T 3: 157,732,369 (GRCm39) Y82* probably null Het
Tbc1d8 G A 1: 39,441,959 (GRCm39) T211I possibly damaging Het
Tbkbp1 T C 11: 97,039,474 (GRCm39) E145G probably damaging Het
Tln1 T C 4: 43,540,588 (GRCm39) N1471S probably benign Het
Tnn T G 1: 159,973,659 (GRCm39) D236A probably damaging Het
Trmt2a C T 16: 18,069,150 (GRCm39) probably benign Het
Ttn A T 2: 76,641,587 (GRCm39) L5176Q possibly damaging Het
Ubxn10 G A 4: 138,463,259 (GRCm39) probably benign Het
Ulk4 G A 9: 120,902,938 (GRCm39) Q1180* probably null Het
Usp43 T A 11: 67,746,331 (GRCm39) K1120N probably damaging Het
Uspl1 T A 5: 149,131,149 (GRCm39) L244Q possibly damaging Het
Vmn1r32 T C 6: 66,530,629 (GRCm39) H49R probably damaging Het
Vmn2r4 T C 3: 64,317,384 (GRCm39) D118G probably damaging Het
Vwce A G 19: 10,627,943 (GRCm39) I468V probably benign Het
Zbtb7c G T 18: 76,279,225 (GRCm39) R561L probably benign Het
Zfp956 T C 6: 47,939,476 (GRCm39) S175P probably damaging Het
Other mutations in Muc6
AlleleSourceChrCoordTypePredicted EffectPPH Score
IGL00091:Muc6 APN 7 141,218,497 (GRCm39) missense probably benign 0.06
IGL00466:Muc6 APN 7 141,232,169 (GRCm39) missense possibly damaging 0.94
IGL00990:Muc6 APN 7 141,638,890 (GRCm38) missense possibly damaging 0.85
IGL01013:Muc6 APN 7 141,234,333 (GRCm39) nonsense probably null
IGL01021:Muc6 APN 7 141,217,075 (GRCm39) missense possibly damaging 0.53
IGL01061:Muc6 APN 7 141,234,720 (GRCm39) missense probably damaging 1.00
IGL01294:Muc6 APN 7 141,232,926 (GRCm39) missense probably damaging 1.00
IGL01449:Muc6 APN 7 141,218,527 (GRCm39) missense possibly damaging 0.92
IGL01474:Muc6 APN 7 141,237,572 (GRCm39) missense probably damaging 1.00
IGL01539:Muc6 APN 7 141,236,306 (GRCm39) missense probably benign 0.07
IGL01541:Muc6 APN 7 141,236,069 (GRCm39) nonsense probably null
IGL01810:Muc6 APN 7 141,237,327 (GRCm39) missense probably damaging 0.97
IGL01941:Muc6 APN 7 141,218,497 (GRCm39) missense probably benign 0.06
IGL01954:Muc6 APN 7 141,218,497 (GRCm39) missense probably benign 0.06
IGL02096:Muc6 APN 7 141,226,117 (GRCm39) intron probably benign
IGL02192:Muc6 APN 7 141,217,717 (GRCm39) missense possibly damaging 0.91
IGL02217:Muc6 APN 7 141,235,889 (GRCm39) missense probably damaging 1.00
IGL02234:Muc6 APN 7 141,226,842 (GRCm39) missense probably benign 0.09
IGL02302:Muc6 APN 7 141,227,763 (GRCm39) missense possibly damaging 0.53
IGL02331:Muc6 APN 7 141,226,726 (GRCm39) missense possibly damaging 0.53
IGL02531:Muc6 APN 7 141,216,853 (GRCm39) missense possibly damaging 0.53
IGL02639:Muc6 APN 7 141,235,843 (GRCm39) splice site probably benign
IGL02851:Muc6 APN 7 141,234,627 (GRCm39) missense probably damaging 1.00
IGL03026:Muc6 APN 7 141,226,414 (GRCm39) intron probably benign
IGL03070:Muc6 APN 7 141,230,834 (GRCm39) splice site probably benign
IGL03108:Muc6 APN 7 141,217,402 (GRCm39) missense possibly damaging 0.93
IGL03350:Muc6 APN 7 141,238,324 (GRCm39) missense probably damaging 1.00
IGL03366:Muc6 APN 7 141,234,349 (GRCm39) missense probably damaging 1.00
anticipation UTSW 7 141,214,363 (GRCm39) frame shift probably null
F5770:Muc6 UTSW 7 141,233,880 (GRCm39) missense probably benign 0.11
IGL03147:Muc6 UTSW 7 141,218,313 (GRCm39) missense possibly damaging 0.95
R0001:Muc6 UTSW 7 141,227,841 (GRCm39) missense possibly damaging 0.53
R0005:Muc6 UTSW 7 141,218,685 (GRCm39) missense possibly damaging 0.72
R0147:Muc6 UTSW 7 141,238,255 (GRCm39) missense probably damaging 1.00
R0153:Muc6 UTSW 7 141,214,029 (GRCm39) missense possibly damaging 0.68
R0227:Muc6 UTSW 7 141,223,981 (GRCm39) intron probably benign
R0234:Muc6 UTSW 7 141,235,939 (GRCm39) missense possibly damaging 0.95
R0234:Muc6 UTSW 7 141,235,939 (GRCm39) missense possibly damaging 0.95
R0304:Muc6 UTSW 7 141,218,313 (GRCm39) missense possibly damaging 0.95
R0379:Muc6 UTSW 7 141,216,868 (GRCm39) missense possibly damaging 0.53
R0385:Muc6 UTSW 7 141,218,313 (GRCm39) missense possibly damaging 0.95
R0423:Muc6 UTSW 7 141,238,548 (GRCm39) missense probably benign 0.01
R0499:Muc6 UTSW 7 141,226,735 (GRCm39) missense probably benign
R0503:Muc6 UTSW 7 141,218,685 (GRCm39) missense possibly damaging 0.72
R0757:Muc6 UTSW 7 141,218,497 (GRCm39) missense probably benign 0.06
R0792:Muc6 UTSW 7 141,223,981 (GRCm39) intron probably benign
R0880:Muc6 UTSW 7 141,217,270 (GRCm39) missense possibly damaging 0.91
R1136:Muc6 UTSW 7 141,218,685 (GRCm39) missense possibly damaging 0.72
R1170:Muc6 UTSW 7 141,230,500 (GRCm39) missense probably damaging 0.99
R1174:Muc6 UTSW 7 141,234,368 (GRCm39) missense probably damaging 1.00
R1175:Muc6 UTSW 7 141,234,368 (GRCm39) missense probably damaging 1.00
R1189:Muc6 UTSW 7 141,232,122 (GRCm39) missense probably damaging 1.00
R1259:Muc6 UTSW 7 141,226,464 (GRCm39) intron probably benign
R1293:Muc6 UTSW 7 141,238,255 (GRCm39) missense probably damaging 1.00
R1295:Muc6 UTSW 7 141,238,144 (GRCm39) missense probably benign 0.04
R1296:Muc6 UTSW 7 141,238,144 (GRCm39) missense probably benign 0.04
R1471:Muc6 UTSW 7 141,234,176 (GRCm39) missense possibly damaging 0.61
R1472:Muc6 UTSW 7 141,238,144 (GRCm39) missense probably benign 0.04
R1548:Muc6 UTSW 7 141,218,685 (GRCm39) missense possibly damaging 0.72
R1548:Muc6 UTSW 7 141,238,368 (GRCm39) splice site probably benign
R1576:Muc6 UTSW 7 141,214,437 (GRCm39) missense possibly damaging 0.92
R1689:Muc6 UTSW 7 141,234,265 (GRCm39) missense probably damaging 1.00
R1702:Muc6 UTSW 7 141,236,752 (GRCm39) missense probably damaging 1.00
R1792:Muc6 UTSW 7 141,214,371 (GRCm39) missense probably benign 0.41
R1924:Muc6 UTSW 7 141,218,313 (GRCm39) missense possibly damaging 0.95
R1938:Muc6 UTSW 7 141,217,011 (GRCm39) missense probably damaging 0.99
R1964:Muc6 UTSW 7 141,226,330 (GRCm39) intron probably benign
R1964:Muc6 UTSW 7 141,226,329 (GRCm39) nonsense probably null
R1975:Muc6 UTSW 7 141,234,368 (GRCm39) missense probably damaging 1.00
R2031:Muc6 UTSW 7 141,218,313 (GRCm39) missense possibly damaging 0.95
R2104:Muc6 UTSW 7 141,213,991 (GRCm39) missense probably benign 0.23
R2201:Muc6 UTSW 7 141,236,075 (GRCm39) missense probably damaging 1.00
R2218:Muc6 UTSW 7 141,233,227 (GRCm39) missense probably benign 0.41
R2245:Muc6 UTSW 7 141,218,313 (GRCm39) missense possibly damaging 0.95
R2261:Muc6 UTSW 7 141,218,313 (GRCm39) missense possibly damaging 0.95
R2271:Muc6 UTSW 7 141,217,423 (GRCm39) missense possibly damaging 0.53
R2272:Muc6 UTSW 7 141,217,423 (GRCm39) missense possibly damaging 0.53
R2284:Muc6 UTSW 7 141,217,837 (GRCm39) missense possibly damaging 0.53
R2310:Muc6 UTSW 7 141,217,444 (GRCm39) missense possibly damaging 0.53
R2566:Muc6 UTSW 7 141,226,651 (GRCm39) missense possibly damaging 0.73
R2975:Muc6 UTSW 7 141,216,951 (GRCm39) missense possibly damaging 0.86
R3406:Muc6 UTSW 7 141,218,313 (GRCm39) missense possibly damaging 0.95
R3423:Muc6 UTSW 7 141,218,313 (GRCm39) missense possibly damaging 0.95
R3548:Muc6 UTSW 7 141,218,313 (GRCm39) missense possibly damaging 0.95
R3693:Muc6 UTSW 7 141,234,946 (GRCm39) splice site probably benign
R3872:Muc6 UTSW 7 141,226,867 (GRCm39) missense probably benign
R4029:Muc6 UTSW 7 141,218,313 (GRCm39) missense possibly damaging 0.95
R4084:Muc6 UTSW 7 141,234,920 (GRCm39) missense probably damaging 1.00
R4126:Muc6 UTSW 7 141,218,313 (GRCm39) missense possibly damaging 0.95
R4410:Muc6 UTSW 7 141,217,576 (GRCm39) missense possibly damaging 0.91
R4508:Muc6 UTSW 7 141,226,356 (GRCm39) intron probably benign
R4509:Muc6 UTSW 7 141,218,313 (GRCm39) missense possibly damaging 0.95
R4518:Muc6 UTSW 7 141,230,489 (GRCm39) missense probably benign 0.03
R4594:Muc6 UTSW 7 141,218,685 (GRCm39) missense possibly damaging 0.72
R4677:Muc6 UTSW 7 141,224,212 (GRCm39) intron probably benign
R4678:Muc6 UTSW 7 141,230,554 (GRCm39) missense probably benign 0.09
R4737:Muc6 UTSW 7 141,226,426 (GRCm39) intron probably benign
R4981:Muc6 UTSW 7 141,218,313 (GRCm39) missense possibly damaging 0.95
R5008:Muc6 UTSW 7 141,223,981 (GRCm39) intron probably benign
R5012:Muc6 UTSW 7 141,216,570 (GRCm39) missense possibly damaging 0.96
R5017:Muc6 UTSW 7 141,226,795 (GRCm39) missense probably benign
R5027:Muc6 UTSW 7 141,216,349 (GRCm39) missense probably benign 0.01
R5058:Muc6 UTSW 7 141,230,491 (GRCm39) missense probably benign 0.01
R5069:Muc6 UTSW 7 141,237,564 (GRCm39) missense probably damaging 1.00
R5126:Muc6 UTSW 7 141,237,564 (GRCm39) missense probably damaging 1.00
R5168:Muc6 UTSW 7 141,223,981 (GRCm39) intron probably benign
R5179:Muc6 UTSW 7 141,218,685 (GRCm39) missense possibly damaging 0.72
R5198:Muc6 UTSW 7 141,218,685 (GRCm39) missense possibly damaging 0.72
R5262:Muc6 UTSW 7 141,237,375 (GRCm39) missense possibly damaging 0.78
R5381:Muc6 UTSW 7 141,217,836 (GRCm39) missense possibly damaging 0.86
R5454:Muc6 UTSW 7 141,235,078 (GRCm39) missense possibly damaging 0.61
R5467:Muc6 UTSW 7 141,216,448 (GRCm39) missense possibly damaging 0.53
R5540:Muc6 UTSW 7 141,235,850 (GRCm39) critical splice donor site probably null
R5800:Muc6 UTSW 7 141,226,690 (GRCm39) splice site probably benign
R5808:Muc6 UTSW 7 141,226,360 (GRCm39) intron probably benign
R5865:Muc6 UTSW 7 141,236,769 (GRCm39) missense probably damaging 0.97
R5919:Muc6 UTSW 7 141,227,837 (GRCm39) missense possibly damaging 0.56
R6024:Muc6 UTSW 7 141,227,841 (GRCm39) missense possibly damaging 0.53
R6064:Muc6 UTSW 7 141,234,640 (GRCm39) missense probably damaging 1.00
R6126:Muc6 UTSW 7 141,218,685 (GRCm39) missense possibly damaging 0.72
R6229:Muc6 UTSW 7 141,226,792 (GRCm39) missense probably benign
R6236:Muc6 UTSW 7 141,218,685 (GRCm39) missense possibly damaging 0.72
R6245:Muc6 UTSW 7 141,235,086 (GRCm39) missense probably damaging 1.00
R6254:Muc6 UTSW 7 141,237,380 (GRCm39) missense probably benign 0.09
R6418:Muc6 UTSW 7 141,224,032 (GRCm39) intron probably benign
R6609:Muc6 UTSW 7 141,226,700 (GRCm39) splice site probably benign
R6610:Muc6 UTSW 7 141,226,700 (GRCm39) splice site probably benign
R6611:Muc6 UTSW 7 141,226,700 (GRCm39) splice site probably benign
R6623:Muc6 UTSW 7 141,223,981 (GRCm39) intron probably benign
R6626:Muc6 UTSW 7 141,223,981 (GRCm39) intron probably benign
R6817:Muc6 UTSW 7 141,237,326 (GRCm39) missense probably damaging 0.99
R6923:Muc6 UTSW 7 141,217,453 (GRCm39) missense possibly damaging 0.91
R6989:Muc6 UTSW 7 141,226,246 (GRCm39) intron probably benign
R7001:Muc6 UTSW 7 141,217,320 (GRCm39) missense probably damaging 0.99
R7046:Muc6 UTSW 7 141,226,456 (GRCm39) intron probably benign
R7097:Muc6 UTSW 7 141,214,363 (GRCm39) frame shift probably null
R7099:Muc6 UTSW 7 141,214,363 (GRCm39) frame shift probably null
R7101:Muc6 UTSW 7 141,214,363 (GRCm39) frame shift probably null
R7107:Muc6 UTSW 7 141,214,363 (GRCm39) frame shift probably null
R7108:Muc6 UTSW 7 141,214,363 (GRCm39) frame shift probably null
R7112:Muc6 UTSW 7 141,235,542 (GRCm39) missense probably damaging 1.00
R7202:Muc6 UTSW 7 141,214,363 (GRCm39) frame shift probably null
R7204:Muc6 UTSW 7 141,214,363 (GRCm39) frame shift probably null
R7205:Muc6 UTSW 7 141,214,363 (GRCm39) frame shift probably null
R7222:Muc6 UTSW 7 141,214,428 (GRCm39) missense unknown
R7230:Muc6 UTSW 7 141,235,479 (GRCm39) missense probably damaging 1.00
R7278:Muc6 UTSW 7 141,226,842 (GRCm39) missense probably benign 0.09
R7483:Muc6 UTSW 7 141,224,245 (GRCm39) missense unknown
R7501:Muc6 UTSW 7 141,217,659 (GRCm39) missense probably damaging 0.98
R7601:Muc6 UTSW 7 141,216,454 (GRCm39) missense unknown
R7641:Muc6 UTSW 7 141,224,247 (GRCm39) missense unknown
R7644:Muc6 UTSW 7 141,217,659 (GRCm39) missense probably damaging 0.98
R7645:Muc6 UTSW 7 141,234,923 (GRCm39) missense probably benign 0.40
R7659:Muc6 UTSW 7 141,216,973 (GRCm39) missense possibly damaging 0.53
R7674:Muc6 UTSW 7 141,224,247 (GRCm39) missense unknown
R7679:Muc6 UTSW 7 141,217,659 (GRCm39) missense probably damaging 0.98
R7680:Muc6 UTSW 7 141,217,659 (GRCm39) missense probably damaging 0.98
R7689:Muc6 UTSW 7 141,217,659 (GRCm39) missense probably damaging 0.98
R7690:Muc6 UTSW 7 141,217,659 (GRCm39) missense probably damaging 0.98
R7760:Muc6 UTSW 7 141,237,322 (GRCm39) splice site probably null
R7806:Muc6 UTSW 7 141,217,387 (GRCm39) missense possibly damaging 0.53
R7809:Muc6 UTSW 7 141,226,638 (GRCm39) missense probably benign 0.02
R7848:Muc6 UTSW 7 141,232,188 (GRCm39) missense possibly damaging 0.53
R7859:Muc6 UTSW 7 141,231,687 (GRCm39) missense probably damaging 0.96
R8054:Muc6 UTSW 7 141,231,748 (GRCm39) missense probably damaging 1.00
R8085:Muc6 UTSW 7 141,226,729 (GRCm39) missense unknown
R8130:Muc6 UTSW 7 141,233,354 (GRCm39) missense probably damaging 0.97
R8210:Muc6 UTSW 7 141,235,673 (GRCm39) critical splice donor site probably null
R8273:Muc6 UTSW 7 141,226,795 (GRCm39) missense unknown
R8294:Muc6 UTSW 7 141,217,263 (GRCm39) missense possibly damaging 0.96
R8329:Muc6 UTSW 7 141,226,525 (GRCm39) missense unknown
R8379:Muc6 UTSW 7 141,230,579 (GRCm39) nonsense probably null
R8537:Muc6 UTSW 7 141,234,184 (GRCm39) missense probably benign 0.03
R8736:Muc6 UTSW 7 141,228,439 (GRCm39) missense possibly damaging 0.53
R8767:Muc6 UTSW 7 141,229,549 (GRCm39) missense probably damaging 1.00
R8902:Muc6 UTSW 7 141,233,791 (GRCm39) missense possibly damaging 0.93
R9009:Muc6 UTSW 7 141,217,018 (GRCm39) missense possibly damaging 0.73
R9010:Muc6 UTSW 7 141,226,351 (GRCm39) missense unknown
R9023:Muc6 UTSW 7 141,237,432 (GRCm39) nonsense probably null
R9058:Muc6 UTSW 7 141,218,154 (GRCm39) missense possibly damaging 0.61
R9257:Muc6 UTSW 7 141,226,738 (GRCm39) missense unknown
R9495:Muc6 UTSW 7 141,237,398 (GRCm39) missense probably damaging 0.98
R9563:Muc6 UTSW 7 141,217,783 (GRCm39) missense possibly damaging 0.53
R9645:Muc6 UTSW 7 141,217,783 (GRCm39) missense possibly damaging 0.53
R9659:Muc6 UTSW 7 141,232,100 (GRCm39) missense probably damaging 1.00
R9733:Muc6 UTSW 7 141,216,310 (GRCm39) missense unknown
R9787:Muc6 UTSW 7 141,227,748 (GRCm39) nonsense probably null
R9788:Muc6 UTSW 7 141,232,100 (GRCm39) missense probably damaging 1.00
V7581:Muc6 UTSW 7 141,233,880 (GRCm39) missense probably benign 0.11
V7583:Muc6 UTSW 7 141,233,880 (GRCm39) missense probably benign 0.11
X0026:Muc6 UTSW 7 141,237,964 (GRCm39) missense possibly damaging 0.94
X0058:Muc6 UTSW 7 141,218,313 (GRCm39) missense possibly damaging 0.95
Z1177:Muc6 UTSW 7 141,237,656 (GRCm39) missense probably benign 0.20
Z1177:Muc6 UTSW 7 141,236,701 (GRCm39) missense probably benign 0.29
Z1177:Muc6 UTSW 7 141,217,827 (GRCm39) missense possibly damaging 0.72
Predicted Primers PCR Primer
(F):5'- TCAGAAGTTGGTGTCACAGAGG -3'
(R):5'- ACCTCCATGCCACTGATGAC -3'

Sequencing Primer
(F):5'- TTGGTGTCACAGAGGAGGTTGAAG -3'
(R):5'- TGTCACGTATACAACCACTGCTG -3'
Posted On 2016-07-15