Incidental Mutation 'R4750:Arhgef1'
List |< first << previous [record 14 of 84] next >> last >|
ID401874
Institutional Source Beutler Lab
Gene Symbol Arhgef1
Ensembl Gene ENSMUSG00000040940
Gene NameRho guanine nucleotide exchange factor (GEF) 1
SynonymsLbcl2, Lsc
MMRRC Submission 042031-MU
Accession Numbers
Is this an essential gene? Possibly non essential (E-score: 0.312) question?
Stock #R4750 (G1)
Quality Score68
Status Validated
Chromosome7
Chromosomal Location24902912-24926594 bp(+) (GRCm38)
Type of Mutationintron
DNA Base Change (assembly) A to G at 24918576 bp
ZygosityHeterozygous
Amino Acid Change
Ref Sequence ENSEMBL: ENSMUSP00000146314 (fasta)
Gene Model predicted gene model for transcript(s): [ENSMUST00000047873] [ENSMUST00000098683] [ENSMUST00000117419] [ENSMUST00000117796] [ENSMUST00000132751] [ENSMUST00000205295] [ENSMUST00000206508]
Predicted Effect probably benign
Transcript: ENSMUST00000047873
SMART Domains Protein: ENSMUSP00000046469
Gene: ENSMUSG00000040940

DomainStartEndE-ValueType
low complexity region 5 13 N/A INTRINSIC
Pfam:RGS-like 40 230 1.3e-72 PFAM
low complexity region 380 400 N/A INTRINSIC
RhoGEF 419 603 1.87e-63 SMART
PH 647 761 4.68e-5 SMART
low complexity region 845 864 N/A INTRINSIC
coiled coil region 867 890 N/A INTRINSIC
Predicted Effect probably benign
Transcript: ENSMUST00000098683
SMART Domains Protein: ENSMUSP00000096280
Gene: ENSMUSG00000040940

DomainStartEndE-ValueType
low complexity region 5 13 N/A INTRINSIC
Pfam:RGS-like 40 230 2.2e-78 PFAM
PDB:3ODW|B 238 384 2e-57 PDB
low complexity region 396 412 N/A INTRINSIC
low complexity region 439 459 N/A INTRINSIC
RhoGEF 478 662 1.87e-63 SMART
PH 706 820 4.68e-5 SMART
low complexity region 904 923 N/A INTRINSIC
coiled coil region 926 949 N/A INTRINSIC
Predicted Effect probably benign
Transcript: ENSMUST00000117419
SMART Domains Protein: ENSMUSP00000113366
Gene: ENSMUSG00000040940

DomainStartEndE-ValueType
low complexity region 5 13 N/A INTRINSIC
Pfam:RGS-like 40 230 1.3e-72 PFAM
low complexity region 380 400 N/A INTRINSIC
RhoGEF 419 603 1.87e-63 SMART
PH 647 761 4.68e-5 SMART
low complexity region 845 864 N/A INTRINSIC
coiled coil region 867 890 N/A INTRINSIC
Predicted Effect probably benign
Transcript: ENSMUST00000117796
SMART Domains Protein: ENSMUSP00000113771
Gene: ENSMUSG00000040940

DomainStartEndE-ValueType
low complexity region 5 13 N/A INTRINSIC
Pfam:RGS-like 40 230 7.3e-73 PFAM
low complexity region 393 409 N/A INTRINSIC
low complexity region 436 456 N/A INTRINSIC
RhoGEF 475 659 1.87e-63 SMART
PH 703 817 4.68e-5 SMART
low complexity region 901 920 N/A INTRINSIC
coiled coil region 923 946 N/A INTRINSIC
Predicted Effect noncoding transcript
Transcript: ENSMUST00000126484
Predicted Effect noncoding transcript
Transcript: ENSMUST00000126918
Predicted Effect noncoding transcript
Transcript: ENSMUST00000129928
Predicted Effect probably benign
Transcript: ENSMUST00000132751
SMART Domains Protein: ENSMUSP00000117008
Gene: ENSMUSG00000040940

DomainStartEndE-ValueType
signal peptide 1 20 N/A INTRINSIC
low complexity region 70 89 N/A INTRINSIC
low complexity region 97 113 N/A INTRINSIC
low complexity region 140 160 N/A INTRINSIC
RhoGEF 179 363 1.87e-63 SMART
PH 407 521 4.68e-5 SMART
Predicted Effect noncoding transcript
Transcript: ENSMUST00000132786
Predicted Effect noncoding transcript
Transcript: ENSMUST00000144714
Predicted Effect noncoding transcript
Transcript: ENSMUST00000145783
Predicted Effect probably benign
Transcript: ENSMUST00000205295
Predicted Effect probably benign
Transcript: ENSMUST00000206508
Meta Mutation Damage Score 0.0898 question?
Coding Region Coverage
  • 1x: 99.2%
  • 3x: 98.6%
  • 10x: 97.2%
  • 20x: 94.9%
Validation Efficiency 97% (89/92)
MGI Phenotype FUNCTION: [Summary is not available for the mouse gene. This summary is for the human ortholog.] Rho GTPases play a fundamental role in numerous cellular processes that are initiated by extracellular stimuli that work through G protein coupled receptors. The encoded protein may form complex with G proteins and stimulate Rho-dependent signals. Multiple alternatively spliced transcript variants have been found for this gene, but the full-length nature of some variants has not been defined. [provided by RefSeq, Jul 2008]
PHENOTYPE: Homozygous mutation of this gene results in impaired humeral immunity, reduced numbers of marginal zone B (MZB) cells, decreased basal T cell proliferation, and reduced basal motility of lymphocytes but enhanced migration of MZB cells after serum activation. [provided by MGI curators]
Allele List at MGI
Other mutations in this stock
Total: 83 list
GeneRefVarChr/LocMutationPredicted EffectZygosity
1110008P14Rik C T 2: 32,379,413 probably null Het
1700074P13Rik A G 6: 40,921,021 W243R probably damaging Het
2510039O18Rik T A 4: 147,941,488 L155Q probably damaging Het
Aadac T C 3: 60,035,817 F48L probably benign Het
Aadat T A 8: 60,526,600 N165K probably benign Het
Acan C A 7: 79,092,718 D557E probably damaging Het
Adamts4 T A 1: 171,251,066 V85D probably benign Het
Agt A G 8: 124,556,937 V481A probably benign Het
Angpt1 T C 15: 42,676,401 N21D probably benign Het
Ankrd52 A C 10: 128,378,089 D38A probably damaging Het
Ap1g2 G T 14: 55,104,365 Q247K probably damaging Het
Apaf1 T C 10: 91,060,188 R341G probably damaging Het
Arf2 T C 11: 103,979,759 probably null Het
Bbox1 T A 2: 110,265,521 Y366F possibly damaging Het
Bmp3 A G 5: 98,872,558 E280G possibly damaging Het
Cd109 CATTTATTTATTTATTTATTTATTTATTTATTTAT CATTTATTTATTTATTTATTTATTTATTTATTTATTTAT 9: 78,712,500 probably benign Het
Cdh12 T A 15: 21,583,808 V578D possibly damaging Het
Cdk19 T C 10: 40,476,199 S282P probably damaging Het
Cfap46 A G 7: 139,679,323 probably null Het
Cfhr3 T A 1: 139,584,828 noncoding transcript Het
Ctrc T A 4: 141,841,523 Y123F probably benign Het
Enpp4 A G 17: 44,102,355 M96T probably damaging Het
Exosc10 T A 4: 148,562,394 S154T possibly damaging Het
Fbxo21 G A 5: 118,000,468 R486H probably benign Het
Foxj3 C A 4: 119,616,590 A204E probably damaging Het
Gas6 T G 8: 13,476,227 D237A probably benign Het
Gimap8 A G 6: 48,650,427 S112G probably benign Het
Gm4787 T C 12: 81,378,367 N339S possibly damaging Het
Gm6185 T C 1: 161,182,363 noncoding transcript Het
Gramd3 A G 18: 56,432,300 E9G probably benign Het
Hmgxb3 A T 18: 61,167,496 D169E probably benign Het
Isl2 T A 9: 55,544,312 V162D probably benign Het
Kcns3 T A 12: 11,091,654 D348V probably damaging Het
Kcp G A 6: 29,484,626 P1318S probably benign Het
Kif12 T A 4: 63,167,783 Q415L probably damaging Het
Lama3 T A 18: 12,504,359 H45Q probably benign Het
Lonp2 A T 8: 86,631,502 K117M probably benign Het
Loxl4 T A 19: 42,605,004 N243Y probably damaging Het
Lrif1 C A 3: 106,735,564 Q662K probably benign Het
Lrrc37a T A 11: 103,455,480 I3187L probably benign Het
Lsg1 A G 16: 30,565,449 I521T probably damaging Het
Mecom T G 3: 29,957,530 K865Q probably damaging Het
Myh10 T C 11: 68,785,314 I790T probably damaging Het
Nek7 C T 1: 138,498,673 S234N probably damaging Het
Nepro T C 16: 44,730,182 L179P probably damaging Het
Nexn A G 3: 152,237,722 C649R probably damaging Het
Nsmf T C 2: 25,055,026 S34P probably damaging Het
Olfr1140 C T 2: 87,746,508 T104I probably benign Het
Olfr1339 T A 4: 118,734,733 V68D possibly damaging Het
Olfr1350 A G 7: 6,570,851 I287V probably benign Het
Olfr1364 A G 13: 21,573,743 S238P possibly damaging Het
Olfr354 T A 2: 36,907,716 S257T probably benign Het
Olfr406 T A 11: 74,269,420 F10L probably benign Het
Olfr417 A G 1: 174,368,922 I2V probably benign Het
Olfr685 A T 7: 105,180,926 I144N probably damaging Het
Olfr702 A G 7: 106,824,307 F73S probably damaging Het
P2rx5 G T 11: 73,164,877 K53N probably damaging Het
Pcdhb20 C A 18: 37,506,131 A570E possibly damaging Het
Pip4k2c T C 10: 127,211,417 H32R unknown Het
Pkhd1 T A 1: 20,524,112 D1259V possibly damaging Het
Plekha7 A T 7: 116,137,311 V889E probably damaging Het
Polr2b A C 5: 77,332,039 E546D possibly damaging Het
Ppm1l A G 3: 69,549,328 T193A probably damaging Het
Ppp1r37 G T 7: 19,531,520 D710E probably benign Het
Prdm4 A G 10: 85,899,221 F679L probably damaging Het
Prkcd A G 14: 30,610,301 M1T probably null Het
Rcor3 A G 1: 192,130,449 Y77H probably damaging Het
Rdh5 T C 10: 128,918,366 E66G possibly damaging Het
Slc12a5 A G 2: 164,982,931 M396V probably benign Het
Slco5a1 T G 1: 12,879,280 T629P probably damaging Het
Smarca5 A C 8: 80,733,707 N133K probably benign Het
Spag5 T C 11: 78,320,052 M927T probably benign Het
Spint4 A T 2: 164,700,146 D39V probably damaging Het
Syt6 T A 3: 103,630,917 *512R probably null Het
Tmem247 T C 17: 86,922,342 C204R probably damaging Het
Tmem72 A G 6: 116,695,434 Y149H probably damaging Het
Trpm6 T C 19: 18,876,064 V1816A probably damaging Het
Usp35 A G 7: 97,310,339 V1008A possibly damaging Het
Washc4 T C 10: 83,591,052 S1075P probably damaging Het
Wdr34 T C 2: 30,033,920 T198A probably benign Het
Xylb G T 9: 119,359,313 G62* probably null Het
Zfp142 T C 1: 74,572,458 E623G probably damaging Het
Zfp239 A G 6: 117,871,739 Y146C probably damaging Het
Other mutations in Arhgef1
AlleleSourceChrCoordTypePredicted EffectPPH Score
IGL00421:Arhgef1 APN 7 24908359 missense possibly damaging 0.93
IGL00901:Arhgef1 APN 7 24912693 missense probably damaging 1.00
IGL01139:Arhgef1 APN 7 24925951 unclassified probably benign
IGL01479:Arhgef1 APN 7 24912603 missense probably benign 0.01
IGL01935:Arhgef1 APN 7 24921882 missense probably damaging 1.00
IGL01944:Arhgef1 APN 7 24925783 critical splice acceptor site probably null
IGL02032:Arhgef1 APN 7 24923371 missense probably benign 0.23
IGL02059:Arhgef1 APN 7 24912552 splice site probably benign
IGL02202:Arhgef1 APN 7 24913429 nonsense probably null
IGL02324:Arhgef1 APN 7 24923815 missense probably damaging 1.00
IGL02328:Arhgef1 APN 7 24923815 missense probably damaging 1.00
IGL03027:Arhgef1 APN 7 24923732 missense probably damaging 0.98
IGL03227:Arhgef1 APN 7 24922851 missense probably damaging 1.00
IGL03404:Arhgef1 APN 7 24916843 missense probably benign 0.07
R0082:Arhgef1 UTSW 7 24912605 nonsense probably null
R0277:Arhgef1 UTSW 7 24923799 unclassified probably benign
R0336:Arhgef1 UTSW 7 24921957 missense possibly damaging 0.77
R0494:Arhgef1 UTSW 7 24919360 intron probably benign
R0668:Arhgef1 UTSW 7 24907920 missense possibly damaging 0.63
R1520:Arhgef1 UTSW 7 24919704 missense probably damaging 1.00
R1531:Arhgef1 UTSW 7 24924998 missense probably damaging 0.99
R1656:Arhgef1 UTSW 7 24913632 missense probably damaging 1.00
R2979:Arhgef1 UTSW 7 24907751 missense unknown
R3855:Arhgef1 UTSW 7 24919272 missense probably damaging 1.00
R3856:Arhgef1 UTSW 7 24919272 missense probably damaging 1.00
R4080:Arhgef1 UTSW 7 24925846 missense probably damaging 0.96
R4081:Arhgef1 UTSW 7 24925846 missense probably damaging 0.96
R4583:Arhgef1 UTSW 7 24912571 missense probably benign 0.09
R4914:Arhgef1 UTSW 7 24923839 missense probably damaging 1.00
R5255:Arhgef1 UTSW 7 24925022 missense probably damaging 1.00
R5275:Arhgef1 UTSW 7 24919352 critical splice donor site probably null
R5295:Arhgef1 UTSW 7 24919352 critical splice donor site probably null
R5430:Arhgef1 UTSW 7 24912307 splice site probably null
R5604:Arhgef1 UTSW 7 24912785 missense probably benign 0.09
R6150:Arhgef1 UTSW 7 24919357 splice site probably null
R6151:Arhgef1 UTSW 7 24917942 missense probably benign 0.00
R6788:Arhgef1 UTSW 7 24919780 splice site probably null
R6943:Arhgef1 UTSW 7 24923731 missense probably benign 0.01
R6988:Arhgef1 UTSW 7 24916923 missense probably benign 0.04
R7422:Arhgef1 UTSW 7 24916036 missense probably benign 0.00
R7701:Arhgef1 UTSW 7 24912578 missense probably benign 0.01
R7706:Arhgef1 UTSW 7 24916881 missense probably damaging 1.00
R7707:Arhgef1 UTSW 7 24916881 missense probably damaging 1.00
R7708:Arhgef1 UTSW 7 24916881 missense probably damaging 1.00
R7995:Arhgef1 UTSW 7 24919216 missense probably damaging 0.99
R8029:Arhgef1 UTSW 7 24919738 missense probably damaging 1.00
Predicted Primers PCR Primer
(F):5'- AGTAAGCTCTGCCTCCCTCATG -3'
(R):5'- AGATCAAAACCCACTGTGGC -3'

Sequencing Primer
(F):5'- TCCAAGCTGCAGTGTCCTG -3'
(R):5'- TGTGGCCCACAGGACCAG -3'
Posted On2016-07-15