Incidental Mutation 'R4805:Krt24'
ID401885
Institutional Source Beutler Lab
Gene Symbol Krt24
Ensembl Gene ENSMUSG00000020913
Gene Namekeratin 24
Synonyms
MMRRC Submission 041999-MU
Accession Numbers
Is this an essential gene? Probably non essential (E-score: 0.188) question?
Stock #R4805 (G1)
Quality Score225
Status Validated
Chromosome11
Chromosomal Location99279959-99285262 bp(-) (GRCm38)
Type of Mutationmissense
DNA Base Change (assembly) A to T at 99283626 bp
ZygosityHeterozygous
Amino Acid Change Isoleucine to Asparagine at position 205 (I205N)
Ref Sequence ENSEMBL: ENSMUSP00000017255 (fasta)
Gene Model predicted gene model for transcript(s): [ENSMUST00000017255]
Predicted Effect possibly damaging
Transcript: ENSMUST00000017255
AA Change: I205N

PolyPhen 2 Score 0.529 (Sensitivity: 0.88; Specificity: 0.90)
SMART Domains Protein: ENSMUSP00000017255
Gene: ENSMUSG00000020913
AA Change: I205N

DomainStartEndE-ValueType
Filament 140 456 5.23e-157 SMART
Meta Mutation Damage Score 0.4653 question?
Coding Region Coverage
  • 1x: 99.1%
  • 3x: 98.3%
  • 10x: 96.4%
  • 20x: 92.7%
Validation Efficiency 99% (69/70)
MGI Phenotype FUNCTION: [Summary is not available for the mouse gene. This summary is for the human ortholog.] This gene encodes a member of the type I (acidic) keratin family, which belongs to the superfamily of intermediate filament (IF) proteins. Keratins are heteropolymeric structural proteins which form the intermediate filament. These filaments, along with actin microfilaments and microtubules, compose the cytoskeleton of epithelial cells. The type I keratin genes are clustered in a region of chromosome 17q12-q21. [provided by RefSeq, Jun 2009]
Allele List at MGI
Other mutations in this stock
Total: 56 list
GeneRefVarChr/LocMutationPredicted EffectZygosity
1810041L15Rik T A 15: 84,417,196 H82L probably damaging Het
4930407I10Rik T A 15: 82,066,427 Y1508* probably null Het
4931414P19Rik T C 14: 54,595,454 E88G probably benign Het
Acaa1b A G 9: 119,156,946 S17P probably benign Het
Arhgef7 G A 8: 11,831,552 E565K probably damaging Het
Arl6ip1 AAAATAAATAAATAAATAAATAAATA AAAATAAATAAATAAATAAATAAATAAATA 7: 118,121,899 probably benign Het
Bpnt1 T A 1: 185,345,307 probably null Het
Ccnt1 C T 15: 98,544,308 V360I probably benign Het
Chd4 T C 6: 125,128,945 S1829P possibly damaging Het
Dennd1b A T 1: 139,053,384 N112I probably damaging Het
Fat2 A T 11: 55,283,979 D1969E probably benign Het
Flywch1 A C 17: 23,760,617 D394E probably benign Het
Gal3st4 T A 5: 138,265,471 probably null Het
Gm14403 T C 2: 177,508,699 L146P probably damaging Het
Gm5283 G T 3: 17,230,959 noncoding transcript Het
Gpr161 T A 1: 165,306,460 L97Q probably damaging Het
Gstm2 A T 3: 107,985,095 M105K possibly damaging Het
Hecw2 A G 1: 53,840,859 Y1264H probably damaging Het
Ifi206 T A 1: 173,481,386 Q348L possibly damaging Het
Ighv1-83 A T 12: 115,963,869 M87K possibly damaging Het
Ighv2-7 A T 12: 113,807,534 S44T probably damaging Het
Ipo7 T A 7: 110,051,484 N884K probably benign Het
Itga2b T C 11: 102,467,866 N75S probably benign Het
Krt20 A G 11: 99,428,985 V431A unknown Het
Lmo2 T C 2: 103,981,062 Y147H probably damaging Het
Lrrc31 A T 3: 30,691,297 L67* probably null Het
Lrrc37a A G 11: 103,504,309 F97L probably benign Het
Mapkap1 G A 2: 34,597,422 probably null Het
Mgat4d T G 8: 83,358,158 probably null Het
Mrgprb3 C T 7: 48,643,306 V166I probably benign Het
Myh11 T A 16: 14,234,465 Q379L possibly damaging Het
Myh7 T C 14: 54,985,133 S782G probably benign Het
Nobox T C 6: 43,305,119 D340G probably damaging Het
Ntn4 C T 10: 93,644,500 R29C probably damaging Het
Olfr1453 T A 19: 13,028,297 I11F probably benign Het
Olfr329-ps G A 11: 58,542,570 T315I probably benign Het
Pikfyve T A 1: 65,268,800 I1845N probably damaging Het
Pramef20 A G 4: 144,377,020 Y179H probably benign Het
Rad21l T G 2: 151,668,007 H58P probably damaging Het
Scnn1g T C 7: 121,746,602 L316S probably damaging Het
Serpina5 G A 12: 104,102,201 V174I probably damaging Het
Shank1 T C 7: 44,343,711 S788P unknown Het
Snap47 A G 11: 59,428,517 V265A possibly damaging Het
Steap3 T A 1: 120,243,886 H163L probably benign Het
Sycp2 T C 2: 178,393,961 probably benign Het
Tet2 A G 3: 133,467,315 F1729L probably benign Het
Thsd7b T C 1: 130,188,539 V1343A probably benign Het
Thumpd2 G A 17: 81,026,701 T486I probably damaging Het
Ttc41 G T 10: 86,729,798 M405I possibly damaging Het
Ttn T C 2: 76,747,529 D24340G probably damaging Het
Vmn1r10 T G 6: 57,113,617 F65V possibly damaging Het
Vmn2r118 G T 17: 55,592,581 D774E probably damaging Het
Vmn2r13 C T 5: 109,156,465 C700Y probably damaging Het
Wsb1 A C 11: 79,240,391 M393R possibly damaging Het
Zmat3 A G 3: 32,343,355 Y214H probably benign Het
Zswim3 C T 2: 164,820,179 T193I possibly damaging Het
Other mutations in Krt24
AlleleSourceChrCoordTypePredicted EffectPPH Score
IGL01907:Krt24 APN 11 99285204 missense unknown
R0128:Krt24 UTSW 11 99280267 missense probably damaging 0.98
R0561:Krt24 UTSW 11 99284613 missense probably damaging 1.00
R1668:Krt24 UTSW 11 99284618 missense probably benign 0.16
R2018:Krt24 UTSW 11 99282451 missense probably damaging 1.00
R2307:Krt24 UTSW 11 99284630 missense possibly damaging 0.48
R3114:Krt24 UTSW 11 99282436 missense possibly damaging 0.85
R3115:Krt24 UTSW 11 99282436 missense possibly damaging 0.85
R3116:Krt24 UTSW 11 99282436 missense possibly damaging 0.85
R3979:Krt24 UTSW 11 99282770 missense probably benign 0.23
R5347:Krt24 UTSW 11 99282730 missense probably damaging 1.00
R5858:Krt24 UTSW 11 99284765 missense probably damaging 1.00
X0028:Krt24 UTSW 11 99281033 nonsense probably null
Z1176:Krt24 UTSW 11 99284886 missense unknown
Predicted Primers PCR Primer
(F):5'- ACCGACCAAGCTCTCTCCTG -3'
(R):5'- TACCCCAACAATTATGGAAGCTG -3'

Sequencing Primer
(F):5'- TTATTTAGGTCACCATCCCCCAAAGG -3'
(R):5'- AAGCTGTTTCCTATTGCAGAGAG -3'
Posted On2016-07-15