Incidental Mutation 'R4722:Dnajc13'
ID401903
Institutional Source Beutler Lab
Gene Symbol Dnajc13
Ensembl Gene ENSMUSG00000032560
Gene NameDnaJ heat shock protein family (Hsp40) member C13
SynonymsLOC382100, D030002L11Rik, Rme8
MMRRC Submission 041987-MU
Accession Numbers
Is this an essential gene? Probably essential (E-score: 0.922) question?
Stock #R4722 (G1)
Quality Score225
Status Validated
Chromosome9
Chromosomal Location104151282-104262930 bp(-) (GRCm38)
Type of Mutationmissense
DNA Base Change (assembly) A to T at 104213818 bp
ZygosityHeterozygous
Amino Acid Change Methionine to Lysine at position 688 (M688K)
Ref Sequence ENSEMBL: ENSMUSP00000139804 (fasta)
Gene Model predicted gene model for transcript(s): [ENSMUST00000035170] [ENSMUST00000186788]
Predicted Effect probably benign
Transcript: ENSMUST00000035170
AA Change: M688K

PolyPhen 2 Score 0.000 (Sensitivity: 1.00; Specificity: 0.00)
SMART Domains Protein: ENSMUSP00000035170
Gene: ENSMUSG00000032560
AA Change: M688K

DomainStartEndE-ValueType
low complexity region 706 719 N/A INTRINSIC
low complexity region 832 843 N/A INTRINSIC
low complexity region 913 926 N/A INTRINSIC
Blast:ARM 927 963 6e-12 BLAST
Pfam:DUF4339 976 1020 1.5e-18 PFAM
Blast:ARM 1071 1110 5e-12 BLAST
DnaJ 1300 1358 5.69e-18 SMART
low complexity region 1417 1426 N/A INTRINSIC
low complexity region 1813 1829 N/A INTRINSIC
Blast:ARM 1843 1884 6e-8 BLAST
low complexity region 1968 1984 N/A INTRINSIC
low complexity region 2006 2016 N/A INTRINSIC
Predicted Effect probably benign
Transcript: ENSMUST00000186788
AA Change: M688K

PolyPhen 2 Score 0.000 (Sensitivity: 1.00; Specificity: 0.00)
SMART Domains Protein: ENSMUSP00000139804
Gene: ENSMUSG00000032560
AA Change: M688K

DomainStartEndE-ValueType
low complexity region 706 719 N/A INTRINSIC
low complexity region 837 848 N/A INTRINSIC
low complexity region 918 931 N/A INTRINSIC
Blast:ARM 932 968 6e-12 BLAST
Pfam:DUF4339 980 1025 8.1e-14 PFAM
Blast:ARM 1076 1115 5e-12 BLAST
DnaJ 1305 1363 5.69e-18 SMART
low complexity region 1422 1431 N/A INTRINSIC
low complexity region 1818 1834 N/A INTRINSIC
Blast:ARM 1848 1889 6e-8 BLAST
low complexity region 1973 1989 N/A INTRINSIC
low complexity region 2011 2021 N/A INTRINSIC
Meta Mutation Damage Score 0.0614 question?
Coding Region Coverage
  • 1x: 99.2%
  • 3x: 98.5%
  • 10x: 96.9%
  • 20x: 94.2%
Validation Efficiency 99% (68/69)
MGI Phenotype FUNCTION: [Summary is not available for the mouse gene. This summary is for the human ortholog.] This gene encodes a member of the Dnaj protein family whose members act as co-chaperones of a partner heat-shock protein by binding to the latter and stimulating ATP hydrolysis. The encoded protein associates with the heat-shock protein Hsc70 and plays a role in clathrin-mediated endocytosis. It may also be involved in post-endocytic transport mechanisms via its associations with other proteins, including the sorting nexin SNX1. Mutations in this gene are associated with Parkinson's disease. [provided by RefSeq, Jun 2016]
Allele List at MGI
Other mutations in this stock
Total: 64 list
GeneRefVarChr/LocMutationPredicted EffectZygosity
2700097O09Rik G T 12: 55,061,137 D92E probably benign Het
Abca17 A G 17: 24,265,429 F1620L probably damaging Het
Abcf1 T C 17: 35,958,041 probably benign Het
Adtrp T C 13: 41,767,347 H248R probably benign Het
Aldh1b1 T G 4: 45,803,472 F337V probably damaging Het
Amz2 C T 11: 109,434,631 L272F probably damaging Het
Asic2 A T 11: 81,968,183 M1K probably null Het
Avpr1a T A 10: 122,449,001 V66E possibly damaging Het
AW554918 C A 18: 25,174,715 Y28* probably null Het
Ccdc130 A T 8: 84,258,810 C277S probably benign Het
Cdc25b C T 2: 131,193,351 P343L probably damaging Het
Chd7 T A 4: 8,822,445 I846K probably damaging Het
Dock2 T A 11: 34,695,471 I505F probably damaging Het
Dpy19l4 A G 4: 11,290,521 V290A possibly damaging Het
Dtl G T 1: 191,556,841 Q254K possibly damaging Het
Enpp2 T G 15: 54,887,589 K265T probably damaging Het
Epm2aip1 TGTCGCCG TG 9: 111,272,084 probably benign Het
Fam133b T A 5: 3,543,949 probably null Het
Fuom A G 7: 140,099,567 probably benign Het
Fut9 T C 4: 25,799,734 probably benign Het
Gas8 T A 8: 123,525,635 I171N possibly damaging Het
Gipc3 T G 10: 81,341,295 D147A probably benign Het
Gkn3 C T 6: 87,383,525 A163T probably damaging Het
Gm5591 T C 7: 38,519,148 K767R probably damaging Het
Kctd8 G A 5: 69,341,201 P34L possibly damaging Het
Kmt2b G A 7: 30,583,202 R403C probably damaging Het
Krt84 A T 15: 101,528,411 I396N probably damaging Het
Lrrk2 C A 15: 91,688,901 F217L probably damaging Het
Med27 T A 2: 29,524,435 D290E probably damaging Het
Mical3 T C 6: 121,038,525 Q184R probably benign Het
Mlxip A T 5: 123,447,202 K591M probably benign Het
Mutyh T A 4: 116,816,872 L233H probably damaging Het
Naip6 G T 13: 100,307,072 H253N possibly damaging Het
Nynrin A G 14: 55,854,395 E56G probably damaging Het
Oip5 C T 2: 119,613,011 probably null Het
Olfr1199 T G 2: 88,756,012 H221P possibly damaging Het
Olfr1211 T C 2: 88,929,980 I112V possibly damaging Het
Olfr1335 T C 4: 118,808,949 N305S probably damaging Het
Olfr17 T A 7: 107,097,570 I35N possibly damaging Het
Olfr485 T A 7: 108,159,238 I212F probably benign Het
Oxr1 T C 15: 41,813,649 S132P probably damaging Het
Pcdhac1 C T 18: 37,091,880 T582I probably damaging Het
Prl7a2 A G 13: 27,660,875 I176T probably damaging Het
Rabgap1l T C 1: 160,342,164 T30A possibly damaging Het
Rapgef2 A G 3: 79,069,173 M1294T probably benign Het
Rbm22 G A 18: 60,564,391 R56H probably damaging Het
Rnmt T A 18: 68,305,881 N20K probably damaging Het
Scn7a T A 2: 66,700,884 T550S possibly damaging Het
Shank1 T A 7: 44,313,214 Y117* probably null Het
Skint5 T A 4: 113,893,855 K331I unknown Het
Slc5a1 A G 5: 33,146,711 Y290C possibly damaging Het
Slfn14 T C 11: 83,283,418 E249G probably benign Het
Smarcal1 T C 1: 72,611,337 S544P probably damaging Het
St6galnac3 A T 3: 153,411,529 Y186N probably damaging Het
Tbc1d1 T C 5: 64,263,557 F346S probably damaging Het
Tdrd5 A T 1: 156,302,375 I75K probably benign Het
Tnrc6a T C 7: 123,192,090 M1737T possibly damaging Het
Toe1 A T 4: 116,805,200 Y283N probably damaging Het
Tubal3 G T 13: 3,928,185 G34C probably damaging Het
Uxs1 A G 1: 43,774,846 L77P probably damaging Het
Vmn1r212 T C 13: 22,883,908 Y85C probably damaging Het
Zdhhc4 A G 5: 143,321,781 S162P probably damaging Het
Zfp712 A G 13: 67,042,113 S117P probably benign Het
Zic4 G T 9: 91,379,204 G164C probably damaging Het
Other mutations in Dnajc13
AlleleSourceChrCoordTypePredicted EffectPPH Score
IGL00743:Dnajc13 APN 9 104162780 missense probably benign 0.15
IGL00754:Dnajc13 APN 9 104174498 nonsense probably null
IGL00914:Dnajc13 APN 9 104212882 missense possibly damaging 0.90
IGL01014:Dnajc13 APN 9 104203218 missense probably damaging 1.00
IGL01077:Dnajc13 APN 9 104231021 missense probably benign 0.11
IGL01137:Dnajc13 APN 9 104160490 missense probably benign
IGL01305:Dnajc13 APN 9 104230637 splice site probably null
IGL01707:Dnajc13 APN 9 104228979 missense probably damaging 1.00
IGL01781:Dnajc13 APN 9 104162359 missense possibly damaging 0.82
IGL01868:Dnajc13 APN 9 104162745 missense possibly damaging 0.83
IGL01950:Dnajc13 APN 9 104190432 missense possibly damaging 0.85
IGL02102:Dnajc13 APN 9 104229009 missense possibly damaging 0.78
IGL02350:Dnajc13 APN 9 104162359 missense possibly damaging 0.82
IGL02357:Dnajc13 APN 9 104162359 missense possibly damaging 0.82
IGL02470:Dnajc13 APN 9 104175747 missense probably benign 0.17
IGL02888:Dnajc13 APN 9 104180062 splice site probably benign
IGL03079:Dnajc13 APN 9 104212869 nonsense probably null
IGL03179:Dnajc13 APN 9 104167435 missense probably benign 0.42
IGL03293:Dnajc13 APN 9 104174426 missense possibly damaging 0.64
PIT4142001:Dnajc13 UTSW 9 104238473 missense probably damaging 0.96
R0323:Dnajc13 UTSW 9 104156892 missense probably damaging 1.00
R0361:Dnajc13 UTSW 9 104167059 missense probably benign 0.18
R0480:Dnajc13 UTSW 9 104200509 missense probably damaging 0.98
R0558:Dnajc13 UTSW 9 104201952 critical splice acceptor site probably null
R0707:Dnajc13 UTSW 9 104172582 missense probably benign 0.12
R0831:Dnajc13 UTSW 9 104172612 missense probably damaging 1.00
R1234:Dnajc13 UTSW 9 104214157 missense possibly damaging 0.64
R1433:Dnajc13 UTSW 9 104180121 missense probably damaging 1.00
R1463:Dnajc13 UTSW 9 104178940 missense probably damaging 1.00
R1464:Dnajc13 UTSW 9 104214167 missense probably benign 0.10
R1464:Dnajc13 UTSW 9 104214167 missense probably benign 0.10
R1489:Dnajc13 UTSW 9 104231035 missense possibly damaging 0.94
R1575:Dnajc13 UTSW 9 104156838 missense probably benign 0.29
R1750:Dnajc13 UTSW 9 104221477 missense probably damaging 0.98
R1903:Dnajc13 UTSW 9 104228937 missense probably damaging 0.98
R2066:Dnajc13 UTSW 9 104221441 missense probably benign 0.01
R2206:Dnajc13 UTSW 9 104203518 missense probably damaging 1.00
R3160:Dnajc13 UTSW 9 104219898 missense possibly damaging 0.57
R3162:Dnajc13 UTSW 9 104219898 missense possibly damaging 0.57
R4158:Dnajc13 UTSW 9 104190442 missense probably damaging 0.96
R4460:Dnajc13 UTSW 9 104181063 missense probably damaging 0.96
R4537:Dnajc13 UTSW 9 104186805 intron probably benign
R4538:Dnajc13 UTSW 9 104186805 intron probably benign
R4631:Dnajc13 UTSW 9 104190417 missense probably damaging 1.00
R4662:Dnajc13 UTSW 9 104207758 missense probably damaging 1.00
R4731:Dnajc13 UTSW 9 104186805 intron probably benign
R4732:Dnajc13 UTSW 9 104186805 intron probably benign
R4758:Dnajc13 UTSW 9 104172574 missense probably damaging 1.00
R4801:Dnajc13 UTSW 9 104175727 missense probably benign 0.16
R4802:Dnajc13 UTSW 9 104175727 missense probably benign 0.16
R4928:Dnajc13 UTSW 9 104233638 missense possibly damaging 0.93
R4944:Dnajc13 UTSW 9 104167387 unclassified probably benign
R4979:Dnajc13 UTSW 9 104186723 missense probably damaging 1.00
R5177:Dnajc13 UTSW 9 104230986 missense probably benign 0.39
R5190:Dnajc13 UTSW 9 104174525 missense probably benign 0.00
R5256:Dnajc13 UTSW 9 104203329 missense possibly damaging 0.86
R5452:Dnajc13 UTSW 9 104192114 missense probably benign 0.01
R5657:Dnajc13 UTSW 9 104228537 missense probably damaging 1.00
R5752:Dnajc13 UTSW 9 104192774 splice site probably null
R5789:Dnajc13 UTSW 9 104214188 missense probably damaging 1.00
R5837:Dnajc13 UTSW 9 104176666 missense possibly damaging 0.88
R5846:Dnajc13 UTSW 9 104190385 missense probably damaging 0.99
R5982:Dnajc13 UTSW 9 104184615 missense possibly damaging 0.77
R6189:Dnajc13 UTSW 9 104213886 missense probably benign 0.12
R6355:Dnajc13 UTSW 9 104203270 missense probably damaging 0.99
R6483:Dnajc13 UTSW 9 104207804 missense probably damaging 0.96
R6613:Dnajc13 UTSW 9 104213877 missense probably benign 0.07
R6962:Dnajc13 UTSW 9 104181009 missense probably benign 0.02
R7048:Dnajc13 UTSW 9 104203414 critical splice donor site probably null
R7101:Dnajc13 UTSW 9 104165022 missense possibly damaging 0.92
R7304:Dnajc13 UTSW 9 104238514 missense probably benign 0.00
R7353:Dnajc13 UTSW 9 104230031 missense possibly damaging 0.89
R7366:Dnajc13 UTSW 9 104184706 missense probably benign 0.43
R7528:Dnajc13 UTSW 9 104178965 missense possibly damaging 0.65
R7635:Dnajc13 UTSW 9 104162367 missense probably benign
R7673:Dnajc13 UTSW 9 104233692 missense probably benign 0.09
X0017:Dnajc13 UTSW 9 104238478 missense possibly damaging 0.90
X0028:Dnajc13 UTSW 9 104165018 missense probably damaging 1.00
Predicted Primers PCR Primer
(F):5'- TGTGGTGACAGTGACACAGC -3'
(R):5'- TAATGGAGAAGGCGTGTACTCTCG -3'

Sequencing Primer
(F):5'- AGTGACACAGCTCCGTGAGTG -3'
(R):5'- GCATCCACACAGTGTTGC -3'
Posted On2016-07-20