Incidental Mutation 'R5077:Insig2'
ID401913
Institutional Source Beutler Lab
Gene Symbol Insig2
Ensembl Gene ENSMUSG00000003721
Gene Nameinsulin induced gene 2
SynonymsC730043J18Rik, Insig-2, 2900053I11Rik
MMRRC Submission 042666-MU
Accession Numbers
Is this an essential gene? Possibly non essential (E-score: 0.329) question?
Stock #R5077 (G1)
Quality Score225
Status Validated
Chromosome1
Chromosomal Location121304353-121332589 bp(-) (GRCm38)
Type of Mutationmissense
DNA Base Change (assembly) A to T at 121312235 bp
ZygosityHeterozygous
Amino Acid Change Valine to Glutamic Acid at position 112 (V112E)
Ref Sequence ENSEMBL: ENSMUSP00000124697 (fasta)
Gene Model predicted gene model for transcript(s): [ENSMUST00000003818] [ENSMUST00000071064] [ENSMUST00000159085] [ENSMUST00000160688] [ENSMUST00000160968] [ENSMUST00000162582] [ENSMUST00000162790] [ENSMUST00000186915]
Predicted Effect probably damaging
Transcript: ENSMUST00000003818
AA Change: V112E

PolyPhen 2 Score 0.984 (Sensitivity: 0.74; Specificity: 0.96)
SMART Domains Protein: ENSMUSP00000003818
Gene: ENSMUSG00000003721
AA Change: V112E

DomainStartEndE-ValueType
Pfam:INSIG 28 211 9.2e-79 PFAM
Predicted Effect probably damaging
Transcript: ENSMUST00000071064
AA Change: V112E

PolyPhen 2 Score 0.984 (Sensitivity: 0.74; Specificity: 0.96)
SMART Domains Protein: ENSMUSP00000065485
Gene: ENSMUSG00000003721
AA Change: V112E

DomainStartEndE-ValueType
Pfam:INSIG 28 211 9.2e-79 PFAM
Predicted Effect probably damaging
Transcript: ENSMUST00000159085
AA Change: V112E

PolyPhen 2 Score 0.984 (Sensitivity: 0.74; Specificity: 0.96)
SMART Domains Protein: ENSMUSP00000124345
Gene: ENSMUSG00000003721
AA Change: V112E

DomainStartEndE-ValueType
Pfam:INSIG 28 211 9.2e-79 PFAM
Predicted Effect noncoding transcript
Transcript: ENSMUST00000159192
Predicted Effect noncoding transcript
Transcript: ENSMUST00000159528
Predicted Effect probably benign
Transcript: ENSMUST00000160688
SMART Domains Protein: ENSMUSP00000123702
Gene: ENSMUSG00000003721

DomainStartEndE-ValueType
Pfam:INSIG 28 76 7.2e-12 PFAM
Predicted Effect probably damaging
Transcript: ENSMUST00000160968
AA Change: V112E

PolyPhen 2 Score 0.984 (Sensitivity: 0.74; Specificity: 0.96)
SMART Domains Protein: ENSMUSP00000123747
Gene: ENSMUSG00000003721
AA Change: V112E

DomainStartEndE-ValueType
Pfam:INSIG 30 211 7.7e-50 PFAM
Predicted Effect noncoding transcript
Transcript: ENSMUST00000162019
Predicted Effect probably benign
Transcript: ENSMUST00000162582
SMART Domains Protein: ENSMUSP00000125046
Gene: ENSMUSG00000003721

DomainStartEndE-ValueType
Pfam:INSIG 28 85 1.3e-18 PFAM
Predicted Effect probably damaging
Transcript: ENSMUST00000162790
AA Change: V112E

PolyPhen 2 Score 0.984 (Sensitivity: 0.74; Specificity: 0.96)
SMART Domains Protein: ENSMUSP00000124697
Gene: ENSMUSG00000003721
AA Change: V112E

DomainStartEndE-ValueType
Pfam:INSIG 28 146 1.3e-49 PFAM
Predicted Effect possibly damaging
Transcript: ENSMUST00000186915
AA Change: V4E

PolyPhen 2 Score 0.613 (Sensitivity: 0.87; Specificity: 0.91)
SMART Domains Protein: ENSMUSP00000140292
Gene: ENSMUSG00000003721
AA Change: V4E

DomainStartEndE-ValueType
Pfam:INSIG 1 103 1.1e-42 PFAM
Meta Mutation Damage Score 0.5444 question?
Coding Region Coverage
  • 1x: 99.3%
  • 3x: 98.7%
  • 10x: 97.4%
  • 20x: 95.7%
Validation Efficiency 93% (51/55)
MGI Phenotype FUNCTION: [Summary is not available for the mouse gene. This summary is for the human ortholog.] The protein encoded by this gene is highly similar to the protein product encoded by gene INSIG1. Both INSIG1 protein and this protein are endoplasmic reticulum proteins that block the processing of sterol regulatory element binding proteins (SREBPs) by binding to SREBP cleavage-activating protein (SCAP), and thus prevent SCAP from escorting SREBPs to the Golgi. [provided by RefSeq, Jul 2008]
Allele List at MGI
Other mutations in this stock
Total: 52 list
GeneRefVarChr/LocMutationPredicted EffectZygosity
2810474O19Rik T G 6: 149,326,030 S191R probably benign Het
Agbl4 A T 4: 111,566,742 M322L probably benign Het
Ankrd55 A G 13: 112,355,988 K231R probably benign Het
Asap1 A C 15: 64,127,423 M534R probably damaging Het
B4galnt2 T A 11: 95,876,314 probably benign Het
Cacna1e A T 1: 154,561,729 probably null Het
Cacna1h T C 17: 25,375,250 I2311M probably benign Het
Capn2 G T 1: 182,472,573 D617E possibly damaging Het
Catsper1 A G 19: 5,335,970 D77G probably damaging Het
Cdc42bpa A T 1: 180,094,533 probably benign Het
Cdca8 T C 4: 124,926,677 K109E probably damaging Het
Dbx1 A G 7: 49,633,494 S223P probably damaging Het
Dlg4 A G 11: 70,027,026 N45S possibly damaging Het
Dlgap2 T G 8: 14,822,691 V723G probably benign Het
Efl1 C A 7: 82,658,087 Q64K probably damaging Het
Eml1 T A 12: 108,506,612 probably benign Het
Fam129a A G 1: 151,714,523 I523V probably benign Het
Fbxw16 A G 9: 109,441,049 probably null Het
Gm10800 A T 2: 98,667,034 L80M probably benign Het
Gm5346 A G 8: 43,627,163 V8A possibly damaging Het
Hist4h4 A G 6: 136,804,115 Y89H probably benign Het
Kcnip3 A G 2: 127,465,877 S123P probably damaging Het
Map3k9 T C 12: 81,734,077 probably null Het
Myo16 T C 8: 10,322,658 V119A probably damaging Het
Naa25 G A 5: 121,424,576 V474M probably benign Het
Nckap1 A T 2: 80,548,933 V219E probably damaging Het
Nrp1 G T 8: 128,500,673 probably null Het
Nsun4 A T 4: 116,048,584 D58E probably benign Het
Obscn G T 11: 59,044,057 A5249D probably damaging Het
Olfr1055 A T 2: 86,347,339 H142Q probably benign Het
Osmr A T 15: 6,844,393 Y174* probably null Het
Pi4k2a T C 19: 42,119,836 probably null Het
Pram1 C T 17: 33,644,904 Q572* probably null Het
Prdm5 C A 6: 65,779,174 T25K probably damaging Het
Psen1 T C 12: 83,724,665 Y240H probably damaging Het
Pygl C T 12: 70,201,892 G318S probably benign Het
Rbck1 A C 2: 152,318,451 M436R probably benign Het
Rmnd1 T C 10: 4,427,488 N64D possibly damaging Het
Rsph4a A G 10: 33,908,279 D299G probably damaging Het
Sema4c T C 1: 36,551,731 S480G probably benign Het
Srp68 T C 11: 116,245,812 D552G probably damaging Het
Syde2 G T 3: 146,002,009 A568S probably damaging Het
Szrd1 G T 4: 141,139,781 probably null Het
Szt2 A T 4: 118,369,616 probably null Het
Tbc1d31 A G 15: 57,955,401 E800G probably benign Het
Tmprss11d C A 5: 86,309,263 probably null Het
Usp37 A G 1: 74,441,561 V895A probably damaging Het
Vmn1r19 T C 6: 57,405,041 I193T probably benign Het
Vmn2r102 T C 17: 19,677,572 V283A probably benign Het
Vps13d C T 4: 145,088,241 G3180D probably damaging Het
Xirp2 A C 2: 67,514,477 D2354A probably benign Het
Zc3h14 T A 12: 98,757,206 probably null Het
Other mutations in Insig2
AlleleSourceChrCoordTypePredicted EffectPPH Score
IGL00231:Insig2 APN 1 121305947 missense probably damaging 1.00
IGL03038:Insig2 APN 1 121319674 missense probably damaging 1.00
R0037:Insig2 UTSW 1 121306920 missense probably damaging 1.00
R1458:Insig2 UTSW 1 121307156 missense probably benign 0.07
R4544:Insig2 UTSW 1 121312192 splice site probably benign
R7325:Insig2 UTSW 1 121306937 missense possibly damaging 0.82
R7839:Insig2 UTSW 1 121312320 missense probably benign 0.01
R7922:Insig2 UTSW 1 121312320 missense probably benign 0.01
X0061:Insig2 UTSW 1 121306963 missense probably damaging 0.99
X0066:Insig2 UTSW 1 121305949 critical splice acceptor site probably null
Predicted Primers PCR Primer
(F):5'- ACAGAGTGTTACCACAGGACTG -3'
(R):5'- GCCAGTCATTTGGGTAAATTTCCC -3'

Sequencing Primer
(F):5'- GTGTTACCACAGGACTGAAAAC -3'
(R):5'- AGTGCCGCTGATGACTTA -3'
Posted On2016-07-22