Incidental Mutation 'R5077:Cdca8'
ID401928
Institutional Source Beutler Lab
Gene Symbol Cdca8
Ensembl Gene ENSMUSG00000028873
Gene Namecell division cycle associated 8
SynonymsBorealin, D4Ertd421e, 4831429J16Rik, DasraB
MMRRC Submission 042666-MU
Accession Numbers

Ncbi RefSeq: NM_026560.4; MGI:1196274

Is this an essential gene? Essential (E-score: 1.000) question?
Stock #R5077 (G1)
Quality Score225
Status Validated
Chromosome4
Chromosomal Location124918465-124939311 bp(-) (GRCm38)
Type of Mutationmissense
DNA Base Change (assembly) T to C at 124926677 bp
ZygosityHeterozygous
Amino Acid Change Lysine to Glutamic Acid at position 109 (K109E)
Ref Sequence ENSEMBL: ENSMUSP00000081319 (fasta)
Gene Model predicted gene model for transcript(s): [ENSMUST00000030690] [ENSMUST00000084296] [ENSMUST00000165281]
Predicted Effect probably damaging
Transcript: ENSMUST00000030690
AA Change: K109E

PolyPhen 2 Score 0.998 (Sensitivity: 0.27; Specificity: 0.99)
SMART Domains Protein: ENSMUSP00000030690
Gene: ENSMUSG00000028873
AA Change: K109E

DomainStartEndE-ValueType
Pfam:Nbl1_Borealin_N 20 76 1.9e-20 PFAM
low complexity region 109 139 N/A INTRINSIC
Pfam:Borealin 148 286 5.9e-27 PFAM
Predicted Effect probably damaging
Transcript: ENSMUST00000084296
AA Change: K109E

PolyPhen 2 Score 0.998 (Sensitivity: 0.27; Specificity: 0.99)
SMART Domains Protein: ENSMUSP00000081319
Gene: ENSMUSG00000028873
AA Change: K109E

DomainStartEndE-ValueType
Pfam:Nbl1_Borealin_N 19 77 2.7e-24 PFAM
low complexity region 109 139 N/A INTRINSIC
Pfam:Borealin 173 286 2.4e-42 PFAM
Predicted Effect noncoding transcript
Transcript: ENSMUST00000125801
Predicted Effect noncoding transcript
Transcript: ENSMUST00000135571
Predicted Effect noncoding transcript
Transcript: ENSMUST00000147074
Predicted Effect probably benign
Transcript: ENSMUST00000165281
SMART Domains Protein: ENSMUSP00000132145
Gene: ENSMUSG00000028873

DomainStartEndE-ValueType
Pfam:Nbl1_Borealin_N 19 77 1.5e-25 PFAM
Meta Mutation Damage Score 0.3726 question?
Coding Region Coverage
  • 1x: 99.3%
  • 3x: 98.7%
  • 10x: 97.4%
  • 20x: 95.7%
Validation Efficiency 93% (51/55)
MGI Phenotype Strain: 3795253
Lethality: E3-E4
FUNCTION: [Summary is not available for the mouse gene. This summary is for the human ortholog.] This gene encodes a component of the chromosomal passenger complex. This complex is an essential regulator of mitosis and cell division. This protein is cell-cycle regulated and is required for chromatin-induced microtubule stabilization and spindle formation. Alternate splicing results in multiple transcript variants. Pseudgenes of this gene are found on chromosomes 7, 8 and 16. [provided by RefSeq, Apr 2013]
PHENOTYPE: Mice homozygous for a reporter allele exhibit early embryonic lethality due to mitotic defects associated with abnormal microtubule organization and mislocalization of the chromosomal passenger protein complex. Blastocysts fail to develop past E3.5 and undergo apoptosis by E5.5. [provided by MGI curators]
Allele List at MGI

All alleles(14) : Targeted(2) Gene trapped(12)

Other mutations in this stock
Total: 52 list
GeneRefVarChr/LocMutationPredicted EffectZygosity
2810474O19Rik T G 6: 149,326,030 S191R probably benign Het
Agbl4 A T 4: 111,566,742 M322L probably benign Het
Ankrd55 A G 13: 112,355,988 K231R probably benign Het
Asap1 A C 15: 64,127,423 M534R probably damaging Het
B4galnt2 T A 11: 95,876,314 probably benign Het
Cacna1e A T 1: 154,561,729 probably null Het
Cacna1h T C 17: 25,375,250 I2311M probably benign Het
Capn2 G T 1: 182,472,573 D617E possibly damaging Het
Catsper1 A G 19: 5,335,970 D77G probably damaging Het
Cdc42bpa A T 1: 180,094,533 probably benign Het
Dbx1 A G 7: 49,633,494 S223P probably damaging Het
Dlg4 A G 11: 70,027,026 N45S possibly damaging Het
Dlgap2 T G 8: 14,822,691 V723G probably benign Het
Efl1 C A 7: 82,658,087 Q64K probably damaging Het
Eml1 T A 12: 108,506,612 probably benign Het
Fam129a A G 1: 151,714,523 I523V probably benign Het
Fbxw16 A G 9: 109,441,049 probably null Het
Gm10800 A T 2: 98,667,034 L80M probably benign Het
Gm5346 A G 8: 43,627,163 V8A possibly damaging Het
Hist4h4 A G 6: 136,804,115 Y89H probably benign Het
Insig2 A T 1: 121,312,235 V112E probably damaging Het
Kcnip3 A G 2: 127,465,877 S123P probably damaging Het
Map3k9 T C 12: 81,734,077 probably null Het
Myo16 T C 8: 10,322,658 V119A probably damaging Het
Naa25 G A 5: 121,424,576 V474M probably benign Het
Nckap1 A T 2: 80,548,933 V219E probably damaging Het
Nrp1 G T 8: 128,500,673 probably null Het
Nsun4 A T 4: 116,048,584 D58E probably benign Het
Obscn G T 11: 59,044,057 A5249D probably damaging Het
Olfr1055 A T 2: 86,347,339 H142Q probably benign Het
Osmr A T 15: 6,844,393 Y174* probably null Het
Pi4k2a T C 19: 42,119,836 probably null Het
Pram1 C T 17: 33,644,904 Q572* probably null Het
Prdm5 C A 6: 65,779,174 T25K probably damaging Het
Psen1 T C 12: 83,724,665 Y240H probably damaging Het
Pygl C T 12: 70,201,892 G318S probably benign Het
Rbck1 A C 2: 152,318,451 M436R probably benign Het
Rmnd1 T C 10: 4,427,488 N64D possibly damaging Het
Rsph4a A G 10: 33,908,279 D299G probably damaging Het
Sema4c T C 1: 36,551,731 S480G probably benign Het
Srp68 T C 11: 116,245,812 D552G probably damaging Het
Syde2 G T 3: 146,002,009 A568S probably damaging Het
Szrd1 G T 4: 141,139,781 probably null Het
Szt2 A T 4: 118,369,616 probably null Het
Tbc1d31 A G 15: 57,955,401 E800G probably benign Het
Tmprss11d C A 5: 86,309,263 probably null Het
Usp37 A G 1: 74,441,561 V895A probably damaging Het
Vmn1r19 T C 6: 57,405,041 I193T probably benign Het
Vmn2r102 T C 17: 19,677,572 V283A probably benign Het
Vps13d C T 4: 145,088,241 G3180D probably damaging Het
Xirp2 A C 2: 67,514,477 D2354A probably benign Het
Zc3h14 T A 12: 98,757,206 probably null Het
Other mutations in Cdca8
AlleleSourceChrCoordTypePredicted EffectPPH Score
P0024:Cdca8 UTSW 4 124926664 critical splice donor site probably null
R0017:Cdca8 UTSW 4 124920375 missense probably benign 0.15
R0017:Cdca8 UTSW 4 124920375 missense probably benign 0.15
R0025:Cdca8 UTSW 4 124921254 missense possibly damaging 0.90
R1024:Cdca8 UTSW 4 124922005 missense probably benign 0.00
R4689:Cdca8 UTSW 4 124931103 missense probably damaging 1.00
R5597:Cdca8 UTSW 4 124919000 missense probably damaging 1.00
R6319:Cdca8 UTSW 4 124921294 missense possibly damaging 0.81
R6390:Cdca8 UTSW 4 124936375 missense probably damaging 1.00
R7818:Cdca8 UTSW 4 124926663 critical splice donor site probably null
X0026:Cdca8 UTSW 4 124926703 missense probably damaging 1.00
Predicted Primers PCR Primer
(F):5'- CCACAAGGGTTTGAAATGCAC -3'
(R):5'- CAAGATCTTTGGTCTTGCATCG -3'

Sequencing Primer
(F):5'- CTTACACCATTAAAGGTCTCGGGAG -3'
(R):5'- GCATCGTGTGGTAGGTTTATAATTC -3'
Posted On2016-07-22