Incidental Mutation 'R5077:Prdm5'
ID401933
Institutional Source Beutler Lab
Gene Symbol Prdm5
Ensembl Gene ENSMUSG00000029913
Gene NamePR domain containing 5
SynonymsPFM2, 4432417F03Rik, 6530401I24Rik, E130112L17Rik
MMRRC Submission 042666-MU
Accession Numbers
Is this an essential gene? Non essential (E-score: 0.000) question?
Stock #R5077 (G1)
Quality Score164
Status Validated
Chromosome6
Chromosomal Location65778988-65937010 bp(+) (GRCm38)
Type of Mutationmissense
DNA Base Change (assembly) C to A at 65779174 bp
ZygosityHeterozygous
Amino Acid Change Threonine to Lysine at position 25 (T25K)
Ref Sequence ENSEMBL: ENSMUSP00000031976 (fasta)
Gene Model predicted gene model for transcript(s): [ENSMUST00000031973] [ENSMUST00000031976] [ENSMUST00000081219] [ENSMUST00000172638]
Predicted Effect probably benign
Transcript: ENSMUST00000031973
AA Change: T25K

PolyPhen 2 Score 0.338 (Sensitivity: 0.90; Specificity: 0.89)
SMART Domains Protein: ENSMUSP00000031973
Gene: ENSMUSG00000029913
AA Change: T25K

DomainStartEndE-ValueType
PDB:3EP0|B 4 101 1e-11 PDB
Blast:SET 8 100 4e-64 BLAST
ZnF_C2H2 105 127 3.16e-3 SMART
ZnF_C2H2 133 155 8.81e-2 SMART
ZnF_C2H2 161 183 1.95e-3 SMART
ZnF_C2H2 189 211 6.78e-3 SMART
ZnF_C2H2 217 240 1.2e-3 SMART
ZnF_C2H2 246 268 4.87e-4 SMART
ZnF_C2H2 274 296 2.4e-3 SMART
ZnF_C2H2 302 324 2.43e-4 SMART
ZnF_C2H2 330 352 3.21e-4 SMART
ZnF_C2H2 358 380 1.45e-2 SMART
ZnF_C2H2 387 410 1.43e-1 SMART
Predicted Effect probably damaging
Transcript: ENSMUST00000031976
AA Change: T25K

PolyPhen 2 Score 0.969 (Sensitivity: 0.77; Specificity: 0.95)
SMART Domains Protein: ENSMUSP00000031976
Gene: ENSMUSG00000029913
AA Change: T25K

DomainStartEndE-ValueType
SET 8 130 2.01e-4 SMART
ZnF_C2H2 167 190 3.39e-3 SMART
ZnF_C2H2 199 221 1.04e-3 SMART
ZnF_C2H2 231 256 1.26e-2 SMART
ZnF_C2H2 264 286 1.95e-3 SMART
ZnF_C2H2 289 311 3.16e-3 SMART
ZnF_C2H2 317 339 8.81e-2 SMART
ZnF_C2H2 345 367 1.95e-3 SMART
ZnF_C2H2 373 395 6.78e-3 SMART
ZnF_C2H2 401 424 1.2e-3 SMART
ZnF_C2H2 430 452 4.87e-4 SMART
ZnF_C2H2 458 480 2.4e-3 SMART
ZnF_C2H2 486 508 2.43e-4 SMART
ZnF_C2H2 514 536 3.21e-4 SMART
ZnF_C2H2 542 564 1.45e-2 SMART
ZnF_C2H2 571 594 1.43e-1 SMART
Predicted Effect possibly damaging
Transcript: ENSMUST00000081219
AA Change: T25K

PolyPhen 2 Score 0.861 (Sensitivity: 0.83; Specificity: 0.93)
SMART Domains Protein: ENSMUSP00000079979
Gene: ENSMUSG00000029913
AA Change: T25K

DomainStartEndE-ValueType
Blast:SET 8 72 2e-34 BLAST
ZnF_C2H2 80 102 2.4e-3 SMART
ZnF_C2H2 108 130 2.43e-4 SMART
ZnF_C2H2 136 158 3.21e-4 SMART
ZnF_C2H2 164 186 1.45e-2 SMART
ZnF_C2H2 193 216 1.43e-1 SMART
Predicted Effect noncoding transcript
Transcript: ENSMUST00000144594
Predicted Effect possibly damaging
Transcript: ENSMUST00000172638
AA Change: T25K

PolyPhen 2 Score 0.861 (Sensitivity: 0.83; Specificity: 0.93)
SMART Domains Protein: ENSMUSP00000133423
Gene: ENSMUSG00000029913
AA Change: T25K

DomainStartEndE-ValueType
SET 8 130 2.01e-4 SMART
ZnF_C2H2 167 190 3.39e-3 SMART
ZnF_C2H2 199 221 1.04e-3 SMART
ZnF_C2H2 231 256 1.26e-2 SMART
ZnF_C2H2 264 286 1.95e-3 SMART
ZnF_C2H2 289 311 3.16e-3 SMART
ZnF_C2H2 317 339 8.81e-2 SMART
ZnF_C2H2 345 367 1.95e-3 SMART
ZnF_C2H2 373 395 6.78e-3 SMART
ZnF_C2H2 401 424 1.2e-3 SMART
ZnF_C2H2 430 452 4.87e-4 SMART
ZnF_C2H2 458 480 2.4e-3 SMART
Predicted Effect noncoding transcript
Transcript: ENSMUST00000173538
Predicted Effect noncoding transcript
Transcript: ENSMUST00000205168
Meta Mutation Damage Score 0.0913 question?
Coding Region Coverage
  • 1x: 99.3%
  • 3x: 98.7%
  • 10x: 97.4%
  • 20x: 95.7%
Validation Efficiency 93% (51/55)
MGI Phenotype FUNCTION: [Summary is not available for the mouse gene. This summary is for the human ortholog.] The protein encoded by this gene is a transcription factor of the PR-domain protein family. It contains a PR-domain and multiple zinc finger motifs. Transcription factors of the PR-domain family are known to be involved in cell differentiation and tumorigenesis. [provided by RefSeq, Jul 2008]
PHENOTYPE: Mice homozygous for a hypomorphic allele display delayed bone ossification with reduced collagen fibril formation, total bone area, bone mineral content and bone mineral density. [provided by MGI curators]
Allele List at MGI
Other mutations in this stock
Total: 52 list
GeneRefVarChr/LocMutationPredicted EffectZygosity
2810474O19Rik T G 6: 149,326,030 S191R probably benign Het
Agbl4 A T 4: 111,566,742 M322L probably benign Het
Ankrd55 A G 13: 112,355,988 K231R probably benign Het
Asap1 A C 15: 64,127,423 M534R probably damaging Het
B4galnt2 T A 11: 95,876,314 probably benign Het
Cacna1e A T 1: 154,561,729 probably null Het
Cacna1h T C 17: 25,375,250 I2311M probably benign Het
Capn2 G T 1: 182,472,573 D617E possibly damaging Het
Catsper1 A G 19: 5,335,970 D77G probably damaging Het
Cdc42bpa A T 1: 180,094,533 probably benign Het
Cdca8 T C 4: 124,926,677 K109E probably damaging Het
Dbx1 A G 7: 49,633,494 S223P probably damaging Het
Dlg4 A G 11: 70,027,026 N45S possibly damaging Het
Dlgap2 T G 8: 14,822,691 V723G probably benign Het
Efl1 C A 7: 82,658,087 Q64K probably damaging Het
Eml1 T A 12: 108,506,612 probably benign Het
Fam129a A G 1: 151,714,523 I523V probably benign Het
Fbxw16 A G 9: 109,441,049 probably null Het
Gm10800 A T 2: 98,667,034 L80M probably benign Het
Gm5346 A G 8: 43,627,163 V8A possibly damaging Het
Hist4h4 A G 6: 136,804,115 Y89H probably benign Het
Insig2 A T 1: 121,312,235 V112E probably damaging Het
Kcnip3 A G 2: 127,465,877 S123P probably damaging Het
Map3k9 T C 12: 81,734,077 probably null Het
Myo16 T C 8: 10,322,658 V119A probably damaging Het
Naa25 G A 5: 121,424,576 V474M probably benign Het
Nckap1 A T 2: 80,548,933 V219E probably damaging Het
Nrp1 G T 8: 128,500,673 probably null Het
Nsun4 A T 4: 116,048,584 D58E probably benign Het
Obscn G T 11: 59,044,057 A5249D probably damaging Het
Olfr1055 A T 2: 86,347,339 H142Q probably benign Het
Osmr A T 15: 6,844,393 Y174* probably null Het
Pi4k2a T C 19: 42,119,836 probably null Het
Pram1 C T 17: 33,644,904 Q572* probably null Het
Psen1 T C 12: 83,724,665 Y240H probably damaging Het
Pygl C T 12: 70,201,892 G318S probably benign Het
Rbck1 A C 2: 152,318,451 M436R probably benign Het
Rmnd1 T C 10: 4,427,488 N64D possibly damaging Het
Rsph4a A G 10: 33,908,279 D299G probably damaging Het
Sema4c T C 1: 36,551,731 S480G probably benign Het
Srp68 T C 11: 116,245,812 D552G probably damaging Het
Syde2 G T 3: 146,002,009 A568S probably damaging Het
Szrd1 G T 4: 141,139,781 probably null Het
Szt2 A T 4: 118,369,616 probably null Het
Tbc1d31 A G 15: 57,955,401 E800G probably benign Het
Tmprss11d C A 5: 86,309,263 probably null Het
Usp37 A G 1: 74,441,561 V895A probably damaging Het
Vmn1r19 T C 6: 57,405,041 I193T probably benign Het
Vmn2r102 T C 17: 19,677,572 V283A probably benign Het
Vps13d C T 4: 145,088,241 G3180D probably damaging Het
Xirp2 A C 2: 67,514,477 D2354A probably benign Het
Zc3h14 T A 12: 98,757,206 probably null Het
Other mutations in Prdm5
AlleleSourceChrCoordTypePredicted EffectPPH Score
IGL01395:Prdm5 APN 6 65870390 missense possibly damaging 0.93
IGL02363:Prdm5 APN 6 65794319 missense probably damaging 1.00
IGL02457:Prdm5 APN 6 65881116 missense probably damaging 1.00
IGL03190:Prdm5 APN 6 65856132 splice site probably benign
IGL03239:Prdm5 APN 6 65886078 splice site probably benign
IGL03377:Prdm5 APN 6 65859473 missense possibly damaging 0.93
R0329:Prdm5 UTSW 6 65862903 splice site probably benign
R0926:Prdm5 UTSW 6 65883547 missense probably damaging 0.99
R1458:Prdm5 UTSW 6 65883601 missense probably damaging 0.99
R1859:Prdm5 UTSW 6 65831279 missense probably benign 0.03
R1956:Prdm5 UTSW 6 65936076 missense probably damaging 1.00
R1996:Prdm5 UTSW 6 65936088 missense probably damaging 1.00
R1997:Prdm5 UTSW 6 65936088 missense probably damaging 1.00
R2019:Prdm5 UTSW 6 65831356 missense probably damaging 0.99
R3082:Prdm5 UTSW 6 65936085 missense probably damaging 1.00
R3819:Prdm5 UTSW 6 65936057 missense possibly damaging 0.92
R4411:Prdm5 UTSW 6 65901787 nonsense probably null
R4981:Prdm5 UTSW 6 65870462 missense probably damaging 0.99
R5089:Prdm5 UTSW 6 65856090 missense probably benign 0.01
R5138:Prdm5 UTSW 6 65856102 nonsense probably null
R5735:Prdm5 UTSW 6 65927990 missense possibly damaging 0.93
R6355:Prdm5 UTSW 6 65883594 missense probably damaging 1.00
R6743:Prdm5 UTSW 6 65883651 missense probably damaging 1.00
R6769:Prdm5 UTSW 6 65862936 missense probably damaging 0.98
R7216:Prdm5 UTSW 6 65927983 nonsense probably null
R7305:Prdm5 UTSW 6 65831260 missense possibly damaging 0.83
R7510:Prdm5 UTSW 6 65927992 missense probably damaging 0.97
R8270:Prdm5 UTSW 6 65936074 missense probably damaging 1.00
X0017:Prdm5 UTSW 6 65869262 missense possibly damaging 0.94
Predicted Primers PCR Primer
(F):5'- CAAACTTTGGGCCAATCAGC -3'
(R):5'- TCAGAATTCAGGAGCCGTCC -3'

Sequencing Primer
(F):5'- AGGAGGGAGGTGGGGATTCTG -3'
(R):5'- AGACTGCAGCCCATGGGA -3'
Posted On2016-07-22