Incidental Mutation 'R5077:Efl1'
ID401937
Institutional Source Beutler Lab
Gene Symbol Efl1
Ensembl Gene ENSMUSG00000038563
Gene Nameelongation factor like GPTase 1
Synonyms6030468D11Rik, 4932434J20Rik, D7Ertd791e, Eftud1
MMRRC Submission 042666-MU
Accession Numbers
Is this an essential gene? Probably non essential (E-score: 0.243) question?
Stock #R5077 (G1)
Quality Score225
Status Validated
Chromosome7
Chromosomal Location82648614-82777852 bp(+) (GRCm38)
Type of Mutationmissense
DNA Base Change (assembly) C to A at 82658087 bp
ZygosityHeterozygous
Amino Acid Change Glutamine to Lysine at position 64 (Q64K)
Ref Sequence ENSEMBL: ENSMUSP00000146350 (fasta)
Gene Model predicted gene model for transcript(s): [ENSMUST00000039881] [ENSMUST00000141726] [ENSMUST00000179489] [ENSMUST00000207868]
Predicted Effect probably damaging
Transcript: ENSMUST00000039881
AA Change: Q64K

PolyPhen 2 Score 1.000 (Sensitivity: 0.00; Specificity: 1.00)
SMART Domains Protein: ENSMUSP00000046046
Gene: ENSMUSG00000038563
AA Change: Q64K

DomainStartEndE-ValueType
Pfam:GTP_EFTU 17 365 7.4e-62 PFAM
low complexity region 435 451 N/A INTRINSIC
Pfam:EFG_II 614 687 4.3e-9 PFAM
EFG_C 986 1075 1.03e-12 SMART
Predicted Effect noncoding transcript
Transcript: ENSMUST00000125245
Predicted Effect probably damaging
Transcript: ENSMUST00000141726
AA Change: Q64K

PolyPhen 2 Score 0.989 (Sensitivity: 0.72; Specificity: 0.97)
SMART Domains Protein: ENSMUSP00000121909
Gene: ENSMUSG00000038563
AA Change: Q64K

DomainStartEndE-ValueType
Pfam:GTP_EFTU 17 222 2.3e-57 PFAM
Pfam:MMR_HSR1 21 147 2e-6 PFAM
Predicted Effect probably damaging
Transcript: ENSMUST00000179489
AA Change: Q64K

PolyPhen 2 Score 1.000 (Sensitivity: 0.00; Specificity: 1.00)
SMART Domains Protein: ENSMUSP00000137061
Gene: ENSMUSG00000038563
AA Change: Q64K

DomainStartEndE-ValueType
Pfam:GTP_EFTU 17 364 8.7e-58 PFAM
low complexity region 435 451 N/A INTRINSIC
Pfam:GTP_EFTU_D2 504 599 1e-7 PFAM
Pfam:EFG_II 614 687 1.8e-9 PFAM
EFG_C 986 1075 1.03e-12 SMART
Predicted Effect probably damaging
Transcript: ENSMUST00000207868
AA Change: Q64K

PolyPhen 2 Score 1.000 (Sensitivity: 0.00; Specificity: 1.00)
Meta Mutation Damage Score 0.2382 question?
Coding Region Coverage
  • 1x: 99.3%
  • 3x: 98.7%
  • 10x: 97.4%
  • 20x: 95.7%
Validation Efficiency 93% (51/55)
MGI Phenotype PHENOTYPE: Mice homozygous for an ENU-induced mutation exhibit late-onset and progressive gait abnormalities. [provided by MGI curators]
Allele List at MGI
Other mutations in this stock
Total: 52 list
GeneRefVarChr/LocMutationPredicted EffectZygosity
2810474O19Rik T G 6: 149,326,030 S191R probably benign Het
Agbl4 A T 4: 111,566,742 M322L probably benign Het
Ankrd55 A G 13: 112,355,988 K231R probably benign Het
Asap1 A C 15: 64,127,423 M534R probably damaging Het
B4galnt2 T A 11: 95,876,314 probably benign Het
Cacna1e A T 1: 154,561,729 probably null Het
Cacna1h T C 17: 25,375,250 I2311M probably benign Het
Capn2 G T 1: 182,472,573 D617E possibly damaging Het
Catsper1 A G 19: 5,335,970 D77G probably damaging Het
Cdc42bpa A T 1: 180,094,533 probably benign Het
Cdca8 T C 4: 124,926,677 K109E probably damaging Het
Dbx1 A G 7: 49,633,494 S223P probably damaging Het
Dlg4 A G 11: 70,027,026 N45S possibly damaging Het
Dlgap2 T G 8: 14,822,691 V723G probably benign Het
Eml1 T A 12: 108,506,612 probably benign Het
Fam129a A G 1: 151,714,523 I523V probably benign Het
Fbxw16 A G 9: 109,441,049 probably null Het
Gm10800 A T 2: 98,667,034 L80M probably benign Het
Gm5346 A G 8: 43,627,163 V8A possibly damaging Het
Hist4h4 A G 6: 136,804,115 Y89H probably benign Het
Insig2 A T 1: 121,312,235 V112E probably damaging Het
Kcnip3 A G 2: 127,465,877 S123P probably damaging Het
Map3k9 T C 12: 81,734,077 probably null Het
Myo16 T C 8: 10,322,658 V119A probably damaging Het
Naa25 G A 5: 121,424,576 V474M probably benign Het
Nckap1 A T 2: 80,548,933 V219E probably damaging Het
Nrp1 G T 8: 128,500,673 probably null Het
Nsun4 A T 4: 116,048,584 D58E probably benign Het
Obscn G T 11: 59,044,057 A5249D probably damaging Het
Olfr1055 A T 2: 86,347,339 H142Q probably benign Het
Osmr A T 15: 6,844,393 Y174* probably null Het
Pi4k2a T C 19: 42,119,836 probably null Het
Pram1 C T 17: 33,644,904 Q572* probably null Het
Prdm5 C A 6: 65,779,174 T25K probably damaging Het
Psen1 T C 12: 83,724,665 Y240H probably damaging Het
Pygl C T 12: 70,201,892 G318S probably benign Het
Rbck1 A C 2: 152,318,451 M436R probably benign Het
Rmnd1 T C 10: 4,427,488 N64D possibly damaging Het
Rsph4a A G 10: 33,908,279 D299G probably damaging Het
Sema4c T C 1: 36,551,731 S480G probably benign Het
Srp68 T C 11: 116,245,812 D552G probably damaging Het
Syde2 G T 3: 146,002,009 A568S probably damaging Het
Szrd1 G T 4: 141,139,781 probably null Het
Szt2 A T 4: 118,369,616 probably null Het
Tbc1d31 A G 15: 57,955,401 E800G probably benign Het
Tmprss11d C A 5: 86,309,263 probably null Het
Usp37 A G 1: 74,441,561 V895A probably damaging Het
Vmn1r19 T C 6: 57,405,041 I193T probably benign Het
Vmn2r102 T C 17: 19,677,572 V283A probably benign Het
Vps13d C T 4: 145,088,241 G3180D probably damaging Het
Xirp2 A C 2: 67,514,477 D2354A probably benign Het
Zc3h14 T A 12: 98,757,206 probably null Het
Other mutations in Efl1
AlleleSourceChrCoordTypePredicted EffectPPH Score
IGL00541:Efl1 APN 7 82658111 missense probably damaging 1.00
IGL00696:Efl1 APN 7 82651872 splice site probably benign
IGL01344:Efl1 APN 7 82681480 splice site probably benign
IGL01871:Efl1 APN 7 82763319 missense possibly damaging 0.64
IGL01941:Efl1 APN 7 82697976 missense probably benign 0.17
IGL02104:Efl1 APN 7 82658055 critical splice acceptor site probably null
IGL02150:Efl1 APN 7 82686691 missense probably benign
IGL02484:Efl1 APN 7 82683039 missense probably damaging 0.98
IGL03140:Efl1 APN 7 82692881 missense probably benign 0.00
IGL03188:Efl1 APN 7 82671701 missense probably damaging 1.00
IGL03014:Efl1 UTSW 7 82651886 missense probably damaging 1.00
PIT4469001:Efl1 UTSW 7 82658165 missense probably benign 0.14
R0148:Efl1 UTSW 7 82671670 missense probably damaging 1.00
R0226:Efl1 UTSW 7 82693011 splice site probably benign
R0638:Efl1 UTSW 7 82651887 missense probably damaging 1.00
R0684:Efl1 UTSW 7 82651886 missense probably damaging 1.00
R1018:Efl1 UTSW 7 82763013 missense possibly damaging 0.94
R1290:Efl1 UTSW 7 82671728 missense probably damaging 1.00
R1720:Efl1 UTSW 7 82683721 missense possibly damaging 0.50
R1933:Efl1 UTSW 7 82763117 nonsense probably null
R1973:Efl1 UTSW 7 82762877 missense probably damaging 1.00
R2016:Efl1 UTSW 7 82753709 missense probably damaging 1.00
R2124:Efl1 UTSW 7 82692913 missense probably damaging 1.00
R2290:Efl1 UTSW 7 82777670 missense probably damaging 1.00
R2415:Efl1 UTSW 7 82697967 missense probably damaging 1.00
R3545:Efl1 UTSW 7 82762810 missense probably benign 0.00
R3688:Efl1 UTSW 7 82762970 missense probably benign 0.00
R4092:Efl1 UTSW 7 82762827 missense probably benign 0.00
R4207:Efl1 UTSW 7 82750816 missense probably damaging 0.98
R4347:Efl1 UTSW 7 82697966 missense probably damaging 1.00
R4425:Efl1 UTSW 7 82763283 missense probably damaging 0.99
R4816:Efl1 UTSW 7 82671719 missense probably damaging 1.00
R4858:Efl1 UTSW 7 82671627 missense probably damaging 1.00
R5185:Efl1 UTSW 7 82772499 missense probably damaging 1.00
R5319:Efl1 UTSW 7 82674506 missense probably damaging 1.00
R5771:Efl1 UTSW 7 82692524 missense probably benign 0.26
R5857:Efl1 UTSW 7 82763189 missense probably benign
R5956:Efl1 UTSW 7 82651899 missense probably damaging 1.00
R6433:Efl1 UTSW 7 82674568 missense probably damaging 1.00
R7131:Efl1 UTSW 7 82658064 missense probably damaging 1.00
R7143:Efl1 UTSW 7 82762680 missense probably damaging 1.00
R7312:Efl1 UTSW 7 82681444 missense probably benign 0.10
R7409:Efl1 UTSW 7 82697913 missense probably damaging 0.98
R7422:Efl1 UTSW 7 82681379 missense probably damaging 1.00
R7453:Efl1 UTSW 7 82681467 missense possibly damaging 0.76
R7504:Efl1 UTSW 7 82683049 missense probably damaging 1.00
R7884:Efl1 UTSW 7 82658099 missense probably damaging 1.00
R7969:Efl1 UTSW 7 82692970 missense probably benign 0.03
R8394:Efl1 UTSW 7 82762778 missense probably benign 0.00
R8702:Efl1 UTSW 7 82750790 critical splice acceptor site probably null
R8924:Efl1 UTSW 7 82762953 missense probably benign 0.03
Z1088:Efl1 UTSW 7 82692850 missense probably benign 0.00
Predicted Primers PCR Primer
(F):5'- TTGAATCCTTCCTGGCTGAGG -3'
(R):5'- CTCACAAGAGACCATCTGGAGAG -3'

Sequencing Primer
(F):5'- CCTGGCTGAGGTGTAAATGAGC -3'
(R):5'- GGCCAGAATGAGATGCATGGAAC -3'
Posted On2016-07-22