Incidental Mutation 'R0414:Dsc1'
Institutional Source Beutler Lab
Gene Symbol Dsc1
Ensembl Gene ENSMUSG00000044322
Gene Namedesmocollin 1
SynonymsDsc1a, Dsc1b
MMRRC Submission 038616-MU
Accession Numbers
Is this an essential gene? Probably non essential (E-score: 0.103) question?
Stock #R0414 (G1)
Quality Score225
Status Validated
Chromosomal Location20084184-20114871 bp(-) (GRCm38)
Type of Mutationmissense
DNA Base Change (assembly) A to T at 20088354 bp
Amino Acid Change Isoleucine to Asparagine at position 688 (I688N)
Ref Sequence ENSEMBL: ENSMUSP00000153639 (fasta)
Gene Model predicted gene model for transcript(s): [ENSMUST00000038710] [ENSMUST00000224432]
Predicted Effect possibly damaging
Transcript: ENSMUST00000038710
AA Change: I688N

PolyPhen 2 Score 0.457 (Sensitivity: 0.89; Specificity: 0.90)
SMART Domains Protein: ENSMUSP00000042303
Gene: ENSMUSG00000044322
AA Change: I688N

low complexity region 16 26 N/A INTRINSIC
Cadherin_pro 29 111 2.61e-41 SMART
CA 155 240 2.78e-9 SMART
CA 264 352 5.94e-27 SMART
CA 375 470 5.27e-10 SMART
CA 493 575 1.18e-21 SMART
Blast:CA 593 672 5e-46 BLAST
transmembrane domain 692 714 N/A INTRINSIC
Predicted Effect possibly damaging
Transcript: ENSMUST00000224432
AA Change: I688N

PolyPhen 2 Score 0.852 (Sensitivity: 0.83; Specificity: 0.93)
Predicted Effect noncoding transcript
Transcript: ENSMUST00000224557
Meta Mutation Damage Score 0.1795 question?
Coding Region Coverage
  • 1x: 99.1%
  • 3x: 98.4%
  • 10x: 96.6%
  • 20x: 93.6%
Validation Efficiency 96% (64/67)
MGI Phenotype FUNCTION: This gene encodes a member of the cadherin family of proteins that mediates adhesion in desmosomes. The encoded preproprotein undergoes proteolytic processing to generate the mature, functional protein. Mice lacking the encoded protein exhibit epidermal fragility together with defects of epidermal barrier and differentiation. The neonatal mice lacking the encoded protein exhibit epidermal lesions and older mice develop chronic dermatitis. This gene is located in a cluster of desmosomal cadherin genes on chromosome 18. Alternate splicing of this gene results in multiple transcript variants encoding different isoforms that may undergo similar proteolytic processing. [provided by RefSeq, Jan 2016]
PHENOTYPE: Mutants with targeted disruptions of this gene have fragile epidermis, flaky skin, and defects in the epidermal barrier, leading to chronic dermatitis and display abnormal epidermal differentiation as indicated by hyperproliferation and overxpression of keratin 6 and 16. [provided by MGI curators]
Allele List at MGI
Other mutations in this stock
Total: 58 list
GeneRefVarChr/LocMutationPredicted EffectZygosity
1700016H13Rik A T 5: 103,649,490 V51E probably benign Het
4922502D21Rik T C 6: 129,326,850 probably benign Het
Abo T C 2: 26,843,416 Y259C probably damaging Het
Adamts5 A G 16: 85,877,906 S457P probably damaging Het
Alk G T 17: 71,899,286 probably benign Het
Alpk2 A G 18: 65,306,159 I1188T probably benign Het
Ambra1 T C 2: 91,875,739 S730P possibly damaging Het
Arhgef2 T C 3: 88,632,268 probably benign Het
B3gnt7 T C 1: 86,305,629 I82T probably damaging Het
B4galnt3 T C 6: 120,216,565 D400G probably benign Het
Bag4 A G 8: 25,767,997 V434A possibly damaging Het
BC055324 T C 1: 163,968,321 I434V probably benign Het
Cfc1 A G 1: 34,537,328 D130G probably damaging Het
Chd4 T C 6: 125,107,480 Y692H probably damaging Het
Cilp2 A G 8: 69,882,993 S452P probably benign Het
Crybg2 GAGAAGAAG GAGAAG 4: 134,072,636 probably benign Het
Dnah2 T C 11: 69,499,238 D727G probably benign Het
Dock10 C A 1: 80,535,933 V1129F possibly damaging Het
Dyrk1a C G 16: 94,663,842 T103R probably damaging Het
Ebf1 C T 11: 44,924,470 R304* probably null Het
Eif2s2 A G 2: 154,884,461 probably benign Het
Endov T G 11: 119,499,571 Y8* probably null Het
Eps15 T A 4: 109,366,480 D485E probably damaging Het
Fam118a C A 15: 85,045,689 S39R probably damaging Het
Fam173b T A 15: 31,617,002 Y126* probably null Het
Fbxo22 T A 9: 55,223,626 M393K possibly damaging Het
Gab1 A G 8: 80,800,289 I60T probably damaging Het
Gapvd1 A G 2: 34,693,427 L1059P probably benign Het
Gbp5 A G 3: 142,507,913 probably null Het
Glb1l2 T A 9: 26,765,104 K487* probably null Het
Hist1h1a A G 13: 23,764,158 probably benign Het
Hmcn1 T C 1: 150,715,822 I1875M possibly damaging Het
Jkamp T C 12: 72,094,145 probably null Het
Kprp C T 3: 92,825,713 C10Y probably damaging Het
Lrig2 A G 3: 104,494,056 probably null Het
Lrrn3 T A 12: 41,453,940 N126I probably damaging Het
Mug1 T C 6: 121,856,554 F325L probably benign Het
Myadm AC ACC 7: 3,296,760 probably null Het
Nagk C T 6: 83,797,267 R87* probably null Het
Nipal4 T A 11: 46,161,908 I77F probably damaging Het
Olfr1217 A G 2: 89,023,146 Y286H probably damaging Het
Osbp2 T C 11: 3,819,932 H250R probably damaging Het
Pcx T C 19: 4,607,642 V378A possibly damaging Het
Pfkp T A 13: 6,593,210 H524L probably benign Het
Picalm A T 7: 90,189,198 N370I possibly damaging Het
Plcl2 A C 17: 50,607,955 D664A possibly damaging Het
Ptpn5 G A 7: 47,083,136 P320S probably benign Het
Scn3a T A 2: 65,525,982 probably benign Het
Sfswap A G 5: 129,504,051 D96G possibly damaging Het
Slfn1 A G 11: 83,121,270 I71V probably benign Het
Spata1 A G 3: 146,476,188 probably null Het
Stx18 T C 5: 38,105,005 probably benign Het
Suox T A 10: 128,671,457 H234L probably benign Het
Tbc1d17 T C 7: 44,846,059 S114G probably benign Het
Tfeb T A 17: 47,788,299 probably null Het
Tnks A C 8: 34,853,309 V736G probably damaging Het
Wdhd1 T C 14: 47,276,588 T4A probably benign Het
Wdr66 A G 5: 123,287,413 probably null Het
Other mutations in Dsc1
AlleleSourceChrCoordTypePredicted EffectPPH Score
IGL00516:Dsc1 APN 18 20101886 missense probably damaging 1.00
IGL00571:Dsc1 APN 18 20110138 missense probably damaging 1.00
IGL00790:Dsc1 APN 18 20094896 missense probably damaging 1.00
IGL00963:Dsc1 APN 18 20111986 missense probably null 0.01
IGL00972:Dsc1 APN 18 20088363 missense probably benign 0.32
IGL01112:Dsc1 APN 18 20094622 missense probably benign 0.02
IGL01458:Dsc1 APN 18 20099138 missense probably damaging 1.00
IGL01607:Dsc1 APN 18 20089663 missense probably damaging 1.00
IGL01794:Dsc1 APN 18 20110183 missense probably damaging 1.00
IGL01959:Dsc1 APN 18 20097225 missense probably damaging 1.00
IGL02066:Dsc1 APN 18 20108803 unclassified probably benign
IGL02365:Dsc1 APN 18 20108816 missense probably damaging 1.00
IGL02714:Dsc1 APN 18 20087485 missense probably damaging 1.00
IGL02959:Dsc1 APN 18 20108885 missense probably damaging 1.00
IGL03019:Dsc1 APN 18 20088364 missense probably benign 0.00
IGL03106:Dsc1 APN 18 20086644 splice site probably null
R0456:Dsc1 UTSW 18 20099112 missense probably damaging 1.00
R0612:Dsc1 UTSW 18 20114516 missense probably damaging 0.96
R0630:Dsc1 UTSW 18 20085862 missense probably damaging 1.00
R0646:Dsc1 UTSW 18 20096057 missense probably damaging 1.00
R0928:Dsc1 UTSW 18 20110249 splice site probably null
R0976:Dsc1 UTSW 18 20095041 splice site probably null
R1221:Dsc1 UTSW 18 20114542 nonsense probably null
R1398:Dsc1 UTSW 18 20088336 missense probably damaging 1.00
R1902:Dsc1 UTSW 18 20095988 missense probably damaging 1.00
R1903:Dsc1 UTSW 18 20095988 missense probably damaging 1.00
R2070:Dsc1 UTSW 18 20088296 splice site probably null
R2119:Dsc1 UTSW 18 20110152 missense probably benign 0.07
R3935:Dsc1 UTSW 18 20097241 missense probably benign 0.00
R4747:Dsc1 UTSW 18 20094558 missense probably damaging 1.00
R5034:Dsc1 UTSW 18 20095027 missense possibly damaging 0.91
R5243:Dsc1 UTSW 18 20099159 missense probably damaging 1.00
R5289:Dsc1 UTSW 18 20101853 missense possibly damaging 0.72
R5300:Dsc1 UTSW 18 20094860 missense probably damaging 1.00
R5354:Dsc1 UTSW 18 20087575 missense probably damaging 1.00
R5376:Dsc1 UTSW 18 20088446 missense probably benign 0.21
R5808:Dsc1 UTSW 18 20086829 nonsense probably null
R5860:Dsc1 UTSW 18 20095024 missense probably damaging 1.00
R6059:Dsc1 UTSW 18 20110242 missense probably damaging 0.98
R6116:Dsc1 UTSW 18 20097299 missense probably benign 0.10
R6351:Dsc1 UTSW 18 20086769 missense probably damaging 1.00
R6422:Dsc1 UTSW 18 20095033 missense probably damaging 1.00
R6811:Dsc1 UTSW 18 20089654 missense probably benign
R6880:Dsc1 UTSW 18 20088372 missense probably damaging 0.99
R6941:Dsc1 UTSW 18 20097189 missense probably benign 0.00
R6997:Dsc1 UTSW 18 20086644 splice site probably null
R7255:Dsc1 UTSW 18 20097273 missense probably benign 0.12
R7456:Dsc1 UTSW 18 20086822 missense probably benign 0.00
R7492:Dsc1 UTSW 18 20107680 missense possibly damaging 0.46
R7503:Dsc1 UTSW 18 20085865 missense probably damaging 1.00
Predicted Primers PCR Primer

Sequencing Primer
(F):5'- gcaaccctaacctaatctttctc -3'
Posted On2013-05-23