Incidental Mutation 'R5077:Fbxw16'
ID401942
Institutional Source Beutler Lab
Gene Symbol Fbxw16
Ensembl Gene ENSMUSG00000074062
Gene NameF-box and WD-40 domain protein 16
Synonyms
MMRRC Submission 042666-MU
Accession Numbers
Is this an essential gene? Probably non essential (E-score: 0.055) question?
Stock #R5077 (G1)
Quality Score225
Status Validated
Chromosome9
Chromosomal Location109432316-109449140 bp(-) (GRCm38)
Type of Mutationcritical splice donor site (2 bp from exon)
DNA Base Change (assembly) A to G at 109441049 bp
ZygosityHeterozygous
Amino Acid Change
Ref Sequence ENSEMBL: ENSMUSP00000082051 (fasta)
Gene Model predicted gene model for transcript(s): [ENSMUST00000084984]
Predicted Effect probably null
Transcript: ENSMUST00000084984
SMART Domains Protein: ENSMUSP00000082051
Gene: ENSMUSG00000074062

DomainStartEndE-ValueType
FBOX 5 45 2.72e-6 SMART
SCOP:d1e1aa_ 128 249 3e-5 SMART
Blast:WD40 137 176 1e-7 BLAST
Predicted Effect noncoding transcript
Transcript: ENSMUST00000196410
Predicted Effect noncoding transcript
Transcript: ENSMUST00000196515
Meta Mutation Damage Score 0.9483 question?
Coding Region Coverage
  • 1x: 99.3%
  • 3x: 98.7%
  • 10x: 97.4%
  • 20x: 95.7%
Validation Efficiency 93% (51/55)
Allele List at MGI
Other mutations in this stock
Total: 52 list
GeneRefVarChr/LocMutationPredicted EffectZygosity
2810474O19Rik T G 6: 149,326,030 S191R probably benign Het
Agbl4 A T 4: 111,566,742 M322L probably benign Het
Ankrd55 A G 13: 112,355,988 K231R probably benign Het
Asap1 A C 15: 64,127,423 M534R probably damaging Het
B4galnt2 T A 11: 95,876,314 probably benign Het
Cacna1e A T 1: 154,561,729 probably null Het
Cacna1h T C 17: 25,375,250 I2311M probably benign Het
Capn2 G T 1: 182,472,573 D617E possibly damaging Het
Catsper1 A G 19: 5,335,970 D77G probably damaging Het
Cdc42bpa A T 1: 180,094,533 probably benign Het
Cdca8 T C 4: 124,926,677 K109E probably damaging Het
Dbx1 A G 7: 49,633,494 S223P probably damaging Het
Dlg4 A G 11: 70,027,026 N45S possibly damaging Het
Dlgap2 T G 8: 14,822,691 V723G probably benign Het
Efl1 C A 7: 82,658,087 Q64K probably damaging Het
Eml1 T A 12: 108,506,612 probably benign Het
Fam129a A G 1: 151,714,523 I523V probably benign Het
Gm10800 A T 2: 98,667,034 L80M probably benign Het
Gm5346 A G 8: 43,627,163 V8A possibly damaging Het
Hist4h4 A G 6: 136,804,115 Y89H probably benign Het
Insig2 A T 1: 121,312,235 V112E probably damaging Het
Kcnip3 A G 2: 127,465,877 S123P probably damaging Het
Map3k9 T C 12: 81,734,077 probably null Het
Myo16 T C 8: 10,322,658 V119A probably damaging Het
Naa25 G A 5: 121,424,576 V474M probably benign Het
Nckap1 A T 2: 80,548,933 V219E probably damaging Het
Nrp1 G T 8: 128,500,673 probably null Het
Nsun4 A T 4: 116,048,584 D58E probably benign Het
Obscn G T 11: 59,044,057 A5249D probably damaging Het
Olfr1055 A T 2: 86,347,339 H142Q probably benign Het
Osmr A T 15: 6,844,393 Y174* probably null Het
Pi4k2a T C 19: 42,119,836 probably null Het
Pram1 C T 17: 33,644,904 Q572* probably null Het
Prdm5 C A 6: 65,779,174 T25K probably damaging Het
Psen1 T C 12: 83,724,665 Y240H probably damaging Het
Pygl C T 12: 70,201,892 G318S probably benign Het
Rbck1 A C 2: 152,318,451 M436R probably benign Het
Rmnd1 T C 10: 4,427,488 N64D possibly damaging Het
Rsph4a A G 10: 33,908,279 D299G probably damaging Het
Sema4c T C 1: 36,551,731 S480G probably benign Het
Srp68 T C 11: 116,245,812 D552G probably damaging Het
Syde2 G T 3: 146,002,009 A568S probably damaging Het
Szrd1 G T 4: 141,139,781 probably null Het
Szt2 A T 4: 118,369,616 probably null Het
Tbc1d31 A G 15: 57,955,401 E800G probably benign Het
Tmprss11d C A 5: 86,309,263 probably null Het
Usp37 A G 1: 74,441,561 V895A probably damaging Het
Vmn1r19 T C 6: 57,405,041 I193T probably benign Het
Vmn2r102 T C 17: 19,677,572 V283A probably benign Het
Vps13d C T 4: 145,088,241 G3180D probably damaging Het
Xirp2 A C 2: 67,514,477 D2354A probably benign Het
Zc3h14 T A 12: 98,757,206 probably null Het
Other mutations in Fbxw16
AlleleSourceChrCoordTypePredicted EffectPPH Score
IGL02139:Fbxw16 APN 9 109436686 missense probably benign 0.34
IGL02801:Fbxw16 APN 9 109441076 missense possibly damaging 0.73
milky_way UTSW 9 109441250 missense probably damaging 1.00
R0041:Fbxw16 UTSW 9 109448164 missense probably damaging 1.00
R0245:Fbxw16 UTSW 9 109436168 missense possibly damaging 0.93
R0389:Fbxw16 UTSW 9 109432482 missense probably benign 0.03
R0652:Fbxw16 UTSW 9 109436168 missense possibly damaging 0.93
R1693:Fbxw16 UTSW 9 109436259 missense possibly damaging 0.74
R1772:Fbxw16 UTSW 9 109439582 missense possibly damaging 0.91
R1965:Fbxw16 UTSW 9 109441221 missense probably damaging 1.00
R2190:Fbxw16 UTSW 9 109436671 missense probably damaging 1.00
R2334:Fbxw16 UTSW 9 109438361 missense probably benign 0.16
R3800:Fbxw16 UTSW 9 109436597 missense probably damaging 0.99
R3976:Fbxw16 UTSW 9 109439629 missense probably benign 0.42
R4298:Fbxw16 UTSW 9 109446557 missense probably benign 0.00
R4914:Fbxw16 UTSW 9 109438177 missense probably benign 0.01
R4948:Fbxw16 UTSW 9 109438347 missense probably damaging 1.00
R4995:Fbxw16 UTSW 9 109441250 missense probably damaging 1.00
R5057:Fbxw16 UTSW 9 109441164 missense probably damaging 1.00
R5111:Fbxw16 UTSW 9 109436728 missense probably benign 0.11
R5294:Fbxw16 UTSW 9 109436644 missense probably benign 0.34
R5901:Fbxw16 UTSW 9 109441217 missense probably benign 0.06
R6295:Fbxw16 UTSW 9 109448769 intron probably benign
R6303:Fbxw16 UTSW 9 109449101 missense probably benign 0.00
R6664:Fbxw16 UTSW 9 109438258 missense probably benign 0.27
R6670:Fbxw16 UTSW 9 109438212 missense probably damaging 1.00
R6890:Fbxw16 UTSW 9 109436742 missense probably benign 0.14
R7056:Fbxw16 UTSW 9 109436284 missense possibly damaging 0.50
R7073:Fbxw16 UTSW 9 109441055 missense probably damaging 1.00
R7344:Fbxw16 UTSW 9 109449035 missense probably benign 0.00
R7396:Fbxw16 UTSW 9 109449023 missense probably damaging 1.00
R7464:Fbxw16 UTSW 9 109439551 missense possibly damaging 0.50
R7568:Fbxw16 UTSW 9 109439589 missense possibly damaging 0.49
R7735:Fbxw16 UTSW 9 109441067 missense probably damaging 1.00
R7808:Fbxw16 UTSW 9 109448154 missense probably damaging 0.96
R7998:Fbxw16 UTSW 9 109436698 missense probably damaging 1.00
Predicted Primers PCR Primer
(F):5'- GTGTCAAAGGCTAAGTTATGGTC -3'
(R):5'- TGATGCTCTTGTTCTCCAGG -3'

Sequencing Primer
(F):5'- AAGGCTAAGTTATGGTCATGTTTATG -3'
(R):5'- GCCCAGTACAGGAATCCTATATTG -3'
Posted On2016-07-22