Incidental Mutation 'R5077:Dlg4'
ID401946
Institutional Source Beutler Lab
Gene Symbol Dlg4
Ensembl Gene ENSMUSG00000020886
Gene Namediscs large MAGUK scaffold protein 4
SynonymsPSD95, Dlgh4, SAP90, PSD-95, SAP90A
MMRRC Submission 042666-MU
Accession Numbers
Is this an essential gene? Non essential (E-score: 0.000) question?
Stock #R5077 (G1)
Quality Score206
Status Validated
Chromosome11
Chromosomal Location70016942-70047522 bp(+) (GRCm38)
Type of Mutationmissense
DNA Base Change (assembly) A to G at 70027026 bp
ZygosityHeterozygous
Amino Acid Change Asparagine to Serine at position 45 (N45S)
Ref Sequence ENSEMBL: ENSMUSP00000115206 (fasta)
Gene Model predicted gene model for transcript(s): [ENSMUST00000018700] [ENSMUST00000108588] [ENSMUST00000108589] [ENSMUST00000123687] [ENSMUST00000124568] [ENSMUST00000132597] [ENSMUST00000133140] [ENSMUST00000134376] [ENSMUST00000135916] [ENSMUST00000143920] [ENSMUST00000231221] [ENSMUST00000231506] [ENSMUST00000231628] [ENSMUST00000232115] [ENSMUST00000232002] [ENSMUST00000231415] [ENSMUST00000232266] [ENSMUST00000231452]
Predicted Effect probably benign
Transcript: ENSMUST00000018700
SMART Domains Protein: ENSMUSP00000018700
Gene: ENSMUSG00000020886

DomainStartEndE-ValueType
MAGUK_N_PEST 10 64 1.36e-4 SMART
PDZ 73 152 3.38e-21 SMART
PDZ 168 247 1.12e-21 SMART
PDZ 321 394 4.13e-25 SMART
SH3 431 497 1.68e-9 SMART
GuKc 533 712 3.65e-68 SMART
Predicted Effect noncoding transcript
Transcript: ENSMUST00000108586
Predicted Effect probably benign
Transcript: ENSMUST00000108588
SMART Domains Protein: ENSMUSP00000104229
Gene: ENSMUSG00000020886

DomainStartEndE-ValueType
MAGUK_N_PEST 10 61 1e-7 SMART
PDZ 70 149 3.38e-21 SMART
PDZ 165 244 1.12e-21 SMART
PDZ 318 391 4.13e-25 SMART
SH3 428 494 1.68e-9 SMART
GuKc 530 709 3.65e-68 SMART
Predicted Effect probably benign
Transcript: ENSMUST00000108589
SMART Domains Protein: ENSMUSP00000104230
Gene: ENSMUSG00000020886

DomainStartEndE-ValueType
signal peptide 1 23 N/A INTRINSIC
MAGUK_N_PEST 53 107 1.36e-4 SMART
PDZ 116 195 3.38e-21 SMART
PDZ 211 290 1.12e-21 SMART
PDZ 364 437 4.13e-25 SMART
SH3 474 540 1.68e-9 SMART
GuKc 576 755 3.65e-68 SMART
Predicted Effect probably benign
Transcript: ENSMUST00000123687
SMART Domains Protein: ENSMUSP00000134545
Gene: ENSMUSG00000020886

DomainStartEndE-ValueType
SH3 11 77 1.68e-9 SMART
GuKc 113 205 7.37e-5 SMART
Predicted Effect probably benign
Transcript: ENSMUST00000124568
SMART Domains Protein: ENSMUSP00000121053
Gene: ENSMUSG00000020886

DomainStartEndE-ValueType
low complexity region 9 36 N/A INTRINSIC
MAGUK_N_PEST 69 123 7.67e-4 SMART
Pfam:PDZ 124 185 7.6e-17 PFAM
Predicted Effect probably benign
Transcript: ENSMUST00000132597
SMART Domains Protein: ENSMUSP00000114165
Gene: ENSMUSG00000020886

DomainStartEndE-ValueType
Pfam:MAGUK_N_PEST 2 43 5.8e-13 PFAM
PDZ 52 131 3.38e-21 SMART
PDZ 147 226 1.12e-21 SMART
Predicted Effect noncoding transcript
Transcript: ENSMUST00000133140
SMART Domains Protein: ENSMUSP00000126707
Gene: ENSMUSG00000020886

DomainStartEndE-ValueType
PDZ 13 92 3.38e-21 SMART
Predicted Effect possibly damaging
Transcript: ENSMUST00000134376
AA Change: N45S

PolyPhen 2 Score 0.710 (Sensitivity: 0.86; Specificity: 0.92)
SMART Domains Protein: ENSMUSP00000115206
Gene: ENSMUSG00000020886
AA Change: N45S

DomainStartEndE-ValueType
MAGUK_N_PEST 10 97 3.39e-37 SMART
PDZ 106 165 1.79e-2 SMART
Predicted Effect probably benign
Transcript: ENSMUST00000135916
SMART Domains Protein: ENSMUSP00000135994
Gene: ENSMUSG00000020886

DomainStartEndE-ValueType
Pfam:PDZ 5 51 6.3e-11 PFAM
Predicted Effect noncoding transcript
Transcript: ENSMUST00000138004
Predicted Effect probably benign
Transcript: ENSMUST00000143920
Predicted Effect unknown
Transcript: ENSMUST00000232659
AA Change: N9S
Predicted Effect probably benign
Transcript: ENSMUST00000231221
Predicted Effect probably benign
Transcript: ENSMUST00000231506
Predicted Effect probably benign
Transcript: ENSMUST00000231628
Predicted Effect probably benign
Transcript: ENSMUST00000232115
Predicted Effect probably benign
Transcript: ENSMUST00000232002
Predicted Effect probably benign
Transcript: ENSMUST00000231415
Predicted Effect probably benign
Transcript: ENSMUST00000232266
Predicted Effect probably benign
Transcript: ENSMUST00000231452
Meta Mutation Damage Score 0.0911 question?
Coding Region Coverage
  • 1x: 99.3%
  • 3x: 98.7%
  • 10x: 97.4%
  • 20x: 95.7%
Validation Efficiency 93% (51/55)
MGI Phenotype FUNCTION: [Summary is not available for the mouse gene. This summary is for the human ortholog.] This gene encodes a member of the membrane-associated guanylate kinase (MAGUK) family. It heteromultimerizes with another MAGUK protein, DLG2, and is recruited into NMDA receptor and potassium channel clusters. These two MAGUK proteins may interact at postsynaptic sites to form a multimeric scaffold for the clustering of receptors, ion channels, and associated signaling proteins. Multiple transcript variants encoding different isoforms have been found for this gene. [provided by RefSeq, Jul 2008]
PHENOTYPE: Homozygotes for a targeted null mutation exhibit severely impaired spatial learning, alterations in long-term potentiation and depression, and lack of hyperalgesia responses in a neuropathic pain model. [provided by MGI curators]
Allele List at MGI
Other mutations in this stock
Total: 52 list
GeneRefVarChr/LocMutationPredicted EffectZygosity
2810474O19Rik T G 6: 149,326,030 S191R probably benign Het
Agbl4 A T 4: 111,566,742 M322L probably benign Het
Ankrd55 A G 13: 112,355,988 K231R probably benign Het
Asap1 A C 15: 64,127,423 M534R probably damaging Het
B4galnt2 T A 11: 95,876,314 probably benign Het
Cacna1e A T 1: 154,561,729 probably null Het
Cacna1h T C 17: 25,375,250 I2311M probably benign Het
Capn2 G T 1: 182,472,573 D617E possibly damaging Het
Catsper1 A G 19: 5,335,970 D77G probably damaging Het
Cdc42bpa A T 1: 180,094,533 probably benign Het
Cdca8 T C 4: 124,926,677 K109E probably damaging Het
Dbx1 A G 7: 49,633,494 S223P probably damaging Het
Dlgap2 T G 8: 14,822,691 V723G probably benign Het
Efl1 C A 7: 82,658,087 Q64K probably damaging Het
Eml1 T A 12: 108,506,612 probably benign Het
Fam129a A G 1: 151,714,523 I523V probably benign Het
Fbxw16 A G 9: 109,441,049 probably null Het
Gm10800 A T 2: 98,667,034 L80M probably benign Het
Gm5346 A G 8: 43,627,163 V8A possibly damaging Het
Hist4h4 A G 6: 136,804,115 Y89H probably benign Het
Insig2 A T 1: 121,312,235 V112E probably damaging Het
Kcnip3 A G 2: 127,465,877 S123P probably damaging Het
Map3k9 T C 12: 81,734,077 probably null Het
Myo16 T C 8: 10,322,658 V119A probably damaging Het
Naa25 G A 5: 121,424,576 V474M probably benign Het
Nckap1 A T 2: 80,548,933 V219E probably damaging Het
Nrp1 G T 8: 128,500,673 probably null Het
Nsun4 A T 4: 116,048,584 D58E probably benign Het
Obscn G T 11: 59,044,057 A5249D probably damaging Het
Olfr1055 A T 2: 86,347,339 H142Q probably benign Het
Osmr A T 15: 6,844,393 Y174* probably null Het
Pi4k2a T C 19: 42,119,836 probably null Het
Pram1 C T 17: 33,644,904 Q572* probably null Het
Prdm5 C A 6: 65,779,174 T25K probably damaging Het
Psen1 T C 12: 83,724,665 Y240H probably damaging Het
Pygl C T 12: 70,201,892 G318S probably benign Het
Rbck1 A C 2: 152,318,451 M436R probably benign Het
Rmnd1 T C 10: 4,427,488 N64D possibly damaging Het
Rsph4a A G 10: 33,908,279 D299G probably damaging Het
Sema4c T C 1: 36,551,731 S480G probably benign Het
Srp68 T C 11: 116,245,812 D552G probably damaging Het
Syde2 G T 3: 146,002,009 A568S probably damaging Het
Szrd1 G T 4: 141,139,781 probably null Het
Szt2 A T 4: 118,369,616 probably null Het
Tbc1d31 A G 15: 57,955,401 E800G probably benign Het
Tmprss11d C A 5: 86,309,263 probably null Het
Usp37 A G 1: 74,441,561 V895A probably damaging Het
Vmn1r19 T C 6: 57,405,041 I193T probably benign Het
Vmn2r102 T C 17: 19,677,572 V283A probably benign Het
Vps13d C T 4: 145,088,241 G3180D probably damaging Het
Xirp2 A C 2: 67,514,477 D2354A probably benign Het
Zc3h14 T A 12: 98,757,206 probably null Het
Other mutations in Dlg4
AlleleSourceChrCoordTypePredicted EffectPPH Score
IGL01753:Dlg4 APN 11 70041347 missense probably damaging 1.00
IGL02260:Dlg4 APN 11 70042267 missense probably damaging 1.00
IGL03097:Dlg4 UTSW 11 70042202 missense probably damaging 1.00
R0103:Dlg4 UTSW 11 70031193 missense probably damaging 1.00
R0103:Dlg4 UTSW 11 70031193 missense probably damaging 1.00
R0628:Dlg4 UTSW 11 70031784 missense probably damaging 1.00
R0734:Dlg4 UTSW 11 70042705 missense probably damaging 1.00
R1587:Dlg4 UTSW 11 70031746 missense possibly damaging 0.88
R1946:Dlg4 UTSW 11 70039575 missense probably damaging 1.00
R2190:Dlg4 UTSW 11 70042604 missense probably damaging 1.00
R2259:Dlg4 UTSW 11 70031370 missense probably damaging 1.00
R2289:Dlg4 UTSW 11 70026926 missense probably damaging 1.00
R2411:Dlg4 UTSW 11 70041929 critical splice donor site probably null
R3161:Dlg4 UTSW 11 70017225 missense probably damaging 0.99
R4059:Dlg4 UTSW 11 70027083 missense probably benign
R4782:Dlg4 UTSW 11 70026954 missense probably damaging 1.00
R4910:Dlg4 UTSW 11 70030925 missense probably damaging 1.00
R5557:Dlg4 UTSW 11 70042280 missense probably damaging 1.00
R5996:Dlg4 UTSW 11 70017231 missense probably benign 0.00
R6649:Dlg4 UTSW 11 70023953 unclassified probably benign
R6653:Dlg4 UTSW 11 70023953 unclassified probably benign
R7155:Dlg4 UTSW 11 70017216 start codon destroyed probably null 0.00
R7284:Dlg4 UTSW 11 70042082 nonsense probably null
R7683:Dlg4 UTSW 11 70039854 missense possibly damaging 0.95
R7976:Dlg4 UTSW 11 70039182 missense probably damaging 0.99
R8051:Dlg4 UTSW 11 70031642 unclassified probably benign
R8408:Dlg4 UTSW 11 70042252 missense possibly damaging 0.81
R8431:Dlg4 UTSW 11 70039562 missense probably benign 0.36
Z1088:Dlg4 UTSW 11 70031130 missense probably damaging 1.00
Z1176:Dlg4 UTSW 11 70041920 missense probably benign 0.00
Predicted Primers PCR Primer
(F):5'- AGGAGTTGGTCAGGCCCTAG -3'
(R):5'- AGGAGTCCAAGGCCCTGATG -3'

Sequencing Primer
(F):5'- CACTGCACTGCTCTGGGAAAAAG -3'
(R):5'- CTGATGCCAGGCCACCC -3'
Posted On2016-07-22