Mutagenetix > Incidental Mutation

Incidental Mutation 'R5077:Pygl'

401950

Institutional Source

Beutler Lab

Gene Symbol

Pygl

Ensembl Gene

ENSMUSG00000021069

Gene Name

liver glycogen phosphorylase

Synonyms

MMRRC Submission

042666-MU

Accession Numbers

Essential gene?

Possibly non essential (E-score: 0.387) question?

Stock #

R5077 (G1)

Quality Score

225

Status

Validated

Chromosome

Chromosomal Location

70190811-70231488 bp(-) (GRCm38)

Type of Mutation

missense

DNA Base Change (assembly)

C to T at 70201892 bp (GRCm38)

Zygosity

Heterozygous

Amino Acid Change

Glycine to Serine at position 318 (G318S)

Ref Sequence

ENSEMBL: ENSMUSP00000071231 (fasta)

Gene Model

predicted gene model for transcript(s): [ENSMUST00000071250] [ENSMUST00000161083]

AlphaFold

Q9ET01

Predicted Effect

probably benign
Transcript: ENSMUST00000071250
AA Change: G318S

PolyPhen 2 Score 0.137 (Sensitivity: 0.92; Specificity: 0.86)

SMART Domains

Protein: ENSMUSP00000071231
Gene: ENSMUSG00000021069
AA Change: G318S

Domain	Start	End	E-Value	Type
Pfam:Phosphorylase	113	829	N/A	PFAM

Predicted Effect

probably benign
Transcript: ENSMUST00000161083
AA Change: G227S

PolyPhen 2 Score 0.030 (Sensitivity: 0.95; Specificity: 0.82)

SMART Domains

Protein: ENSMUSP00000125585
Gene: ENSMUSG00000021069
AA Change: G227S

Domain	Start	End	E-Value	Type
Pfam:Phosphorylase	21	739	N/A	PFAM

Predicted Effect

noncoding transcript
Transcript: ENSMUST00000162613

Predicted Effect

noncoding transcript
Transcript: ENSMUST00000222093

Meta Mutation Damage Score

0.1353

Coding Region Coverage

1x: 99.3%
3x: 98.7%
10x: 97.4%
20x: 95.7%

Validation Efficiency

93% (51/55)

MGI Phenotype

FUNCTION: [Summary is not available for the mouse gene. This summary is for the human ortholog.] This gene encodes a homodimeric protein that catalyses the cleavage of alpha-1,4-glucosidic bonds to release glucose-1-phosphate from liver glycogen stores. This protein switches from inactive phosphorylase B to active phosphorylase A by phosphorylation of serine residue 15. Activity of this enzyme is further regulated by multiple allosteric effectors and hormonal controls. Humans have three glycogen phosphorylase genes that encode distinct isozymes that are primarily expressed in liver, brain and muscle, respectively. The liver isozyme serves the glycemic demands of the body in general while the brain and muscle isozymes supply just those tissues. In glycogen storage disease type VI, also known as Hers disease, mutations in liver glycogen phosphorylase inhibit the conversion of glycogen to glucose and results in moderate hypoglycemia, mild ketosis, growth retardation and hepatomegaly. Alternative splicing results in multiple transcript variants encoding different isoforms.[provided by RefSeq, Feb 2011]

Allele List at MGI

Other mutations in this stock

Total: 52 list
Gene	Ref	Var	Chr/Loc	Mutation	Predicted Effect	Zygosity
2810474O19Rik	T	G	6: 149,326,030	S191R	probably benign	Het
Agbl4	A	T	4: 111,566,742	M322L	probably benign	Het
Ankrd55	A	G	13: 112,355,988	K231R	probably benign	Het
Asap1	A	C	15: 64,127,423	M534R	probably damaging	Het
B4galnt2	T	A	11: 95,876,314		probably benign	Het
Cacna1e	A	T	1: 154,561,729		probably null	Het
Cacna1h	T	C	17: 25,375,250	I2311M	probably benign	Het
Capn2	G	T	1: 182,472,573	D617E	possibly damaging	Het
Catsper1	A	G	19: 5,335,970	D77G	probably damaging	Het
Cdc42bpa	A	T	1: 180,094,533		probably benign	Het
Cdca8	T	C	4: 124,926,677	K109E	probably damaging	Het
Dbx1	A	G	7: 49,633,494	S223P	probably damaging	Het
Dlg4	A	G	11: 70,027,026	N45S	possibly damaging	Het
Dlgap2	T	G	8: 14,822,691	V723G	probably benign	Het
Efl1	C	A	7: 82,658,087	Q64K	probably damaging	Het
Eml1	T	A	12: 108,506,612		probably benign	Het
Fam129a	A	G	1: 151,714,523	I523V	probably benign	Het
Fbxw16	A	G	9: 109,441,049		probably null	Het
Gm10800	A	T	2: 98,667,034	L80M	probably benign	Het
Gm5346	A	G	8: 43,627,163	V8A	possibly damaging	Het
Hist4h4	A	G	6: 136,804,115	Y89H	probably benign	Het
Insig2	A	T	1: 121,312,235	V112E	probably damaging	Het
Kcnip3	A	G	2: 127,465,877	S123P	probably damaging	Het
Map3k9	T	C	12: 81,734,077		probably null	Het
Myo16	T	C	8: 10,322,658	V119A	probably damaging	Het
Naa25	G	A	5: 121,424,576	V474M	probably benign	Het
Nckap1	A	T	2: 80,548,933	V219E	probably damaging	Het
Nrp1	G	T	8: 128,500,673		probably null	Het
Nsun4	A	T	4: 116,048,584	D58E	probably benign	Het
Obscn	G	T	11: 59,044,057	A5249D	probably damaging	Het
Olfr1055	A	T	2: 86,347,339	H142Q	probably benign	Het
Osmr	A	T	15: 6,844,393	Y174*	probably null	Het
Pi4k2a	T	C	19: 42,119,836		probably null	Het
Pram1	C	T	17: 33,644,904	Q572*	probably null	Het
Prdm5	C	A	6: 65,779,174	T25K	probably damaging	Het
Psen1	T	C	12: 83,724,665	Y240H	probably damaging	Het
Rbck1	A	C	2: 152,318,451	M436R	probably benign	Het
Rmnd1	T	C	10: 4,427,488	N64D	possibly damaging	Het
Rsph4a	A	G	10: 33,908,279	D299G	probably damaging	Het
Sema4c	T	C	1: 36,551,731	S480G	probably benign	Het
Srp68	T	C	11: 116,245,812	D552G	probably damaging	Het
Syde2	G	T	3: 146,002,009	A568S	probably damaging	Het
Szrd1	G	T	4: 141,139,781		probably null	Het
Szt2	A	T	4: 118,369,616		probably null	Het
Tbc1d31	A	G	15: 57,955,401	E800G	probably benign	Het
Tmprss11d	C	A	5: 86,309,263		probably null	Het
Usp37	A	G	1: 74,441,561	V895A	probably damaging	Het
Vmn1r19	T	C	6: 57,405,041	I193T	probably benign	Het
Vmn2r102	T	C	17: 19,677,572	V283A	probably benign	Het
Vps13d	C	T	4: 145,088,241	G3180D	probably damaging	Het
Xirp2	A	C	2: 67,514,477	D2354A	probably benign	Het
Zc3h14	T	A	12: 98,757,206		probably null	Het

Other mutations in Pygl

Allele	Source	Chr	Coord	Type	Predicted Effect	PPH Score
IGL00425:Pygl	APN	12	70191092	missense	probably damaging	1.00
IGL00903:Pygl	APN	12	70207742	missense	probably damaging	1.00
IGL01965:Pygl	APN	12	70191114	missense	probably benign	0.00
IGL02347:Pygl	APN	12	70201892	missense	probably benign	0.14
IGL02403:Pygl	APN	12	70194258	missense	probably benign
IGL02501:Pygl	APN	12	70191134	missense	probably benign	0.05
IGL02727:Pygl	APN	12	70207668	splice site	probably null
IGL03125:Pygl	APN	12	70197482	missense	probably damaging	1.00
IGL03158:Pygl	APN	12	70195675	missense	probably damaging	1.00
IGL03202:Pygl	APN	12	70199646	missense	probably benign
IGL03368:Pygl	APN	12	70191152	missense	probably benign
R0096:Pygl	UTSW	12	70191166	splice site	probably benign
R0096:Pygl	UTSW	12	70191166	splice site	probably benign
R0524:Pygl	UTSW	12	70207724	missense	probably damaging	1.00
R0883:Pygl	UTSW	12	70206404	missense	probably damaging	0.97
R0894:Pygl	UTSW	12	70194374	splice site	probably benign
R0905:Pygl	UTSW	12	70211017	splice site	probably benign
R1494:Pygl	UTSW	12	70199730	missense	probably damaging	0.98
R1621:Pygl	UTSW	12	70191092	missense	probably damaging	1.00
R1647:Pygl	UTSW	12	70197010	missense	possibly damaging	0.60
R3082:Pygl	UTSW	12	70197529	missense	probably damaging	1.00
R3845:Pygl	UTSW	12	70198443	missense	probably benign	0.12
R3876:Pygl	UTSW	12	70201339	missense	probably damaging	1.00
R4358:Pygl	UTSW	12	70195690	missense	probably damaging	1.00
R4614:Pygl	UTSW	12	70210979	splice site	probably null
R4707:Pygl	UTSW	12	70207758	missense	possibly damaging	0.69
R4908:Pygl	UTSW	12	70197033	missense	probably null
R4940:Pygl	UTSW	12	70206381	missense	probably damaging	1.00
R5186:Pygl	UTSW	12	70201344	missense	probably damaging	1.00
R5726:Pygl	UTSW	12	70191142	nonsense	probably null
R5953:Pygl	UTSW	12	70219627	missense	probably damaging	1.00
R5957:Pygl	UTSW	12	70199720	missense	probably damaging	0.99
R6020:Pygl	UTSW	12	70216654	missense	probably damaging	1.00
R6024:Pygl	UTSW	12	70197067	missense	probably benign	0.09
R7050:Pygl	UTSW	12	70219622	missense	probably damaging	1.00
R7159:Pygl	UTSW	12	70197406	missense	probably benign	0.41
R7194:Pygl	UTSW	12	70194320	missense	probably benign
R7283:Pygl	UTSW	12	70216568	missense	possibly damaging	0.92
R7360:Pygl	UTSW	12	70227532	missense	probably benign	0.11
R7446:Pygl	UTSW	12	70197010	missense	probably benign
R7637:Pygl	UTSW	12	70197795	splice site	probably null
R7886:Pygl	UTSW	12	70206356	splice site	probably null
R8054:Pygl	UTSW	12	70227339	critical splice donor site	probably null
R8693:Pygl	UTSW	12	70197406	missense	probably benign	0.41
R8753:Pygl	UTSW	12	70195626	missense	probably damaging	1.00
R8803:Pygl	UTSW	12	70195616	missense	probably damaging	1.00
R8842:Pygl	UTSW	12	70227594	intron	probably benign
R9192:Pygl	UTSW	12	70197048	missense	probably damaging	0.99
R9221:Pygl	UTSW	12	70195627	missense	probably damaging	1.00
R9437:Pygl	UTSW	12	70200151	missense	probably damaging	1.00
R9750:Pygl	UTSW	12	70198529	missense	possibly damaging	0.68
Z1176:Pygl	UTSW	12	70222874	missense	probably benign	0.09

Predicted Primers

PCR Primer
(F):5'- TGGCAATCTTCCCTGTGGAC -3'
(R):5'- TTGAACAGGGTTTCAGGGAAGC -3'

Sequencing Primer
(F):5'- ACCCTTGTTACAGAGGGTGCATATC -3'
(R):5'- GGGAAGCAAAAGTTGATACTTCCTC -3'

Posted On

2016-07-22