Incidental Mutation 'R5077:Ankrd55'
ID401955
Institutional Source Beutler Lab
Gene Symbol Ankrd55
Ensembl Gene ENSMUSG00000049985
Gene Nameankyrin repeat domain 55
SynonymsC030011J08Rik
MMRRC Submission 042666-MU
Accession Numbers
Is this an essential gene? Non essential (E-score: 0.000) question?
Stock #R5077 (G1)
Quality Score225
Status Not validated
Chromosome13
Chromosomal Location112288451-112384002 bp(+) (GRCm38)
Type of Mutationmissense
DNA Base Change (assembly) A to G at 112355988 bp
ZygosityHeterozygous
Amino Acid Change Lysine to Arginine at position 231 (K231R)
Ref Sequence ENSEMBL: ENSMUSP00000129726 (fasta)
Gene Model predicted gene model for transcript(s): [ENSMUST00000022275] [ENSMUST00000165593] [ENSMUST00000168684]
Predicted Effect probably benign
Transcript: ENSMUST00000022275
AA Change: K231R

PolyPhen 2 Score 0.096 (Sensitivity: 0.93; Specificity: 0.85)
SMART Domains Protein: ENSMUSP00000022275
Gene: ENSMUSG00000049985
AA Change: K231R

DomainStartEndE-ValueType
Blast:ANK 25 54 1e-9 BLAST
ANK 59 88 7.64e-6 SMART
ANK 92 121 4.18e2 SMART
ANK 125 156 4.86e1 SMART
ANK 160 189 5.32e-5 SMART
ANK 193 222 7.59e-1 SMART
ANK 229 257 2.97e2 SMART
ANK 263 292 5.71e-5 SMART
ANK 296 326 1.63e0 SMART
low complexity region 528 543 N/A INTRINSIC
Predicted Effect probably benign
Transcript: ENSMUST00000165593
AA Change: K203R

PolyPhen 2 Score 0.003 (Sensitivity: 0.98; Specificity: 0.44)
SMART Domains Protein: ENSMUSP00000126199
Gene: ENSMUSG00000049985
AA Change: K203R

DomainStartEndE-ValueType
Blast:ANK 1 26 8e-8 BLAST
ANK 31 60 7.64e-6 SMART
ANK 64 93 4.18e2 SMART
ANK 97 128 4.86e1 SMART
ANK 132 161 5.32e-5 SMART
ANK 165 194 7.59e-1 SMART
ANK 201 229 2.97e2 SMART
ANK 235 264 5.71e-5 SMART
ANK 268 298 1.63e0 SMART
low complexity region 500 515 N/A INTRINSIC
Predicted Effect probably benign
Transcript: ENSMUST00000168684
AA Change: K231R

PolyPhen 2 Score 0.185 (Sensitivity: 0.92; Specificity: 0.87)
SMART Domains Protein: ENSMUSP00000129726
Gene: ENSMUSG00000049985
AA Change: K231R

DomainStartEndE-ValueType
Blast:ANK 25 54 9e-10 BLAST
ANK 59 88 7.64e-6 SMART
ANK 92 121 4.18e2 SMART
ANK 125 156 4.86e1 SMART
ANK 160 189 5.32e-5 SMART
ANK 193 222 7.59e-1 SMART
ANK 229 257 2.97e2 SMART
Predicted Effect noncoding transcript
Transcript: ENSMUST00000224393
Coding Region Coverage
  • 1x: 99.3%
  • 3x: 98.7%
  • 10x: 97.4%
  • 20x: 95.7%
Validation Efficiency 93% (51/55)
Allele List at MGI
Other mutations in this stock
Total: 52 list
GeneRefVarChr/LocMutationPredicted EffectZygosity
2810474O19Rik T G 6: 149,326,030 S191R probably benign Het
Agbl4 A T 4: 111,566,742 M322L probably benign Het
Asap1 A C 15: 64,127,423 M534R probably damaging Het
B4galnt2 T A 11: 95,876,314 probably benign Het
Cacna1e A T 1: 154,561,729 probably null Het
Cacna1h T C 17: 25,375,250 I2311M probably benign Het
Capn2 G T 1: 182,472,573 D617E possibly damaging Het
Catsper1 A G 19: 5,335,970 D77G probably damaging Het
Cdc42bpa A T 1: 180,094,533 probably benign Het
Cdca8 T C 4: 124,926,677 K109E probably damaging Het
Dbx1 A G 7: 49,633,494 S223P probably damaging Het
Dlg4 A G 11: 70,027,026 N45S possibly damaging Het
Dlgap2 T G 8: 14,822,691 V723G probably benign Het
Efl1 C A 7: 82,658,087 Q64K probably damaging Het
Eml1 T A 12: 108,506,612 probably benign Het
Fam129a A G 1: 151,714,523 I523V probably benign Het
Fbxw16 A G 9: 109,441,049 probably null Het
Gm10800 A T 2: 98,667,034 L80M probably benign Het
Gm5346 A G 8: 43,627,163 V8A possibly damaging Het
Hist4h4 A G 6: 136,804,115 Y89H probably benign Het
Insig2 A T 1: 121,312,235 V112E probably damaging Het
Kcnip3 A G 2: 127,465,877 S123P probably damaging Het
Map3k9 T C 12: 81,734,077 probably null Het
Myo16 T C 8: 10,322,658 V119A probably damaging Het
Naa25 G A 5: 121,424,576 V474M probably benign Het
Nckap1 A T 2: 80,548,933 V219E probably damaging Het
Nrp1 G T 8: 128,500,673 probably null Het
Nsun4 A T 4: 116,048,584 D58E probably benign Het
Obscn G T 11: 59,044,057 A5249D probably damaging Het
Olfr1055 A T 2: 86,347,339 H142Q probably benign Het
Osmr A T 15: 6,844,393 Y174* probably null Het
Pi4k2a T C 19: 42,119,836 probably null Het
Pram1 C T 17: 33,644,904 Q572* probably null Het
Prdm5 C A 6: 65,779,174 T25K probably damaging Het
Psen1 T C 12: 83,724,665 Y240H probably damaging Het
Pygl C T 12: 70,201,892 G318S probably benign Het
Rbck1 A C 2: 152,318,451 M436R probably benign Het
Rmnd1 T C 10: 4,427,488 N64D possibly damaging Het
Rsph4a A G 10: 33,908,279 D299G probably damaging Het
Sema4c T C 1: 36,551,731 S480G probably benign Het
Srp68 T C 11: 116,245,812 D552G probably damaging Het
Syde2 G T 3: 146,002,009 A568S probably damaging Het
Szrd1 G T 4: 141,139,781 probably null Het
Szt2 A T 4: 118,369,616 probably null Het
Tbc1d31 A G 15: 57,955,401 E800G probably benign Het
Tmprss11d C A 5: 86,309,263 probably null Het
Usp37 A G 1: 74,441,561 V895A probably damaging Het
Vmn1r19 T C 6: 57,405,041 I193T probably benign Het
Vmn2r102 T C 17: 19,677,572 V283A probably benign Het
Vps13d C T 4: 145,088,241 G3180D probably damaging Het
Xirp2 A C 2: 67,514,477 D2354A probably benign Het
Zc3h14 T A 12: 98,757,206 probably null Het
Other mutations in Ankrd55
AlleleSourceChrCoordTypePredicted EffectPPH Score
IGL00484:Ankrd55 APN 13 112367794 missense probably benign 0.01
IGL01372:Ankrd55 APN 13 112323143 missense probably damaging 1.00
IGL01554:Ankrd55 APN 13 112323067 missense possibly damaging 0.87
IGL01700:Ankrd55 APN 13 112381168 missense probably benign 0.16
IGL02366:Ankrd55 APN 13 112318460 missense probably damaging 1.00
IGL03368:Ankrd55 APN 13 112318556 splice site probably benign
crescat UTSW 13 112348863 critical splice donor site probably null
I0000:Ankrd55 UTSW 13 112348725 splice site probably benign
R0547:Ankrd55 UTSW 13 112368223 missense probably benign 0.03
R0781:Ankrd55 UTSW 13 112381233 splice site probably benign
R0981:Ankrd55 UTSW 13 112323076 missense possibly damaging 0.78
R1072:Ankrd55 UTSW 13 112348842 missense possibly damaging 0.83
R1469:Ankrd55 UTSW 13 112367926 missense probably benign 0.39
R1469:Ankrd55 UTSW 13 112367926 missense probably benign 0.39
R2187:Ankrd55 UTSW 13 112383505 missense probably benign 0.01
R4430:Ankrd55 UTSW 13 112323183 critical splice donor site probably null
R4753:Ankrd55 UTSW 13 112363475 missense probably benign
R4846:Ankrd55 UTSW 13 112363454 missense probably benign 0.00
R4911:Ankrd55 UTSW 13 112323039 splice site probably null
R4996:Ankrd55 UTSW 13 112356088 missense possibly damaging 0.68
R5007:Ankrd55 UTSW 13 112367932 missense probably benign
R5118:Ankrd55 UTSW 13 112355939 missense probably benign 0.00
R5350:Ankrd55 UTSW 13 112336226 missense probably damaging 1.00
R5367:Ankrd55 UTSW 13 112318502 missense probably damaging 1.00
R5560:Ankrd55 UTSW 13 112383490 missense probably benign
R5888:Ankrd55 UTSW 13 112355919 missense possibly damaging 0.62
R6130:Ankrd55 UTSW 13 112318446 missense probably damaging 1.00
R6589:Ankrd55 UTSW 13 112348863 critical splice donor site probably null
R6994:Ankrd55 UTSW 13 112368300 missense probably benign 0.42
R7100:Ankrd55 UTSW 13 112356110 missense probably benign 0.00
R7247:Ankrd55 UTSW 13 112336253 missense probably damaging 0.97
R7340:Ankrd55 UTSW 13 112355963 missense probably damaging 0.99
R7694:Ankrd55 UTSW 13 112367964 missense probably damaging 1.00
R8053:Ankrd55 UTSW 13 112323153 missense probably damaging 1.00
Predicted Primers PCR Primer
(F):5'- TGCCAAGCTGGGTCTGTTAG -3'
(R):5'- TCAGGCACCATATTACCAGC -3'

Sequencing Primer
(F):5'- CAAGCTGGGTCTGTTAGTCCTC -3'
(R):5'- GGCACCATATTACCAGCAATTAGGG -3'
Posted On2016-07-22