Incidental Mutation 'R5077:Osmr'
ID401956
Institutional Source Beutler Lab
Gene Symbol Osmr
Ensembl Gene ENSMUSG00000022146
Gene Nameoncostatin M receptor
SynonymsOSMRB
MMRRC Submission 042666-MU
Accession Numbers
Is this an essential gene? Probably non essential (E-score: 0.070) question?
Stock #R5077 (G1)
Quality Score225
Status Validated
Chromosome15
Chromosomal Location6813577-6874969 bp(-) (GRCm38)
Type of Mutationnonsense
DNA Base Change (assembly) A to T at 6844393 bp
ZygosityHeterozygous
Amino Acid Change Tyrosine to Stop codon at position 174 (Y174*)
Ref Sequence ENSEMBL: ENSMUSP00000135204 (fasta)
Gene Model predicted gene model for transcript(s): [ENSMUST00000022746] [ENSMUST00000176826]
Predicted Effect probably null
Transcript: ENSMUST00000022746
AA Change: Y174*
SMART Domains Protein: ENSMUSP00000022746
Gene: ENSMUSG00000022146
AA Change: Y174*

DomainStartEndE-ValueType
signal peptide 1 23 N/A INTRINSIC
low complexity region 26 35 N/A INTRINSIC
Blast:FN3 234 317 9e-38 BLAST
FN3 330 412 6.25e-3 SMART
FN3 427 512 2.75e0 SMART
FN3 523 607 7.02e1 SMART
FN3 619 720 3.17e-4 SMART
transmembrane domain 736 758 N/A INTRINSIC
low complexity region 776 787 N/A INTRINSIC
Predicted Effect noncoding transcript
Transcript: ENSMUST00000175862
Predicted Effect probably null
Transcript: ENSMUST00000176826
AA Change: Y174*
SMART Domains Protein: ENSMUSP00000135204
Gene: ENSMUSG00000022146
AA Change: Y174*

DomainStartEndE-ValueType
signal peptide 1 23 N/A INTRINSIC
low complexity region 26 35 N/A INTRINSIC
Blast:FN3 234 317 9e-38 BLAST
FN3 330 412 6.25e-3 SMART
FN3 427 512 2.75e0 SMART
FN3 523 606 2.77e1 SMART
FN3 618 719 3.17e-4 SMART
transmembrane domain 735 757 N/A INTRINSIC
low complexity region 775 786 N/A INTRINSIC
Predicted Effect noncoding transcript
Transcript: ENSMUST00000177478
Meta Mutation Damage Score 0.9755 question?
Coding Region Coverage
  • 1x: 99.3%
  • 3x: 98.7%
  • 10x: 97.4%
  • 20x: 95.7%
Validation Efficiency 93% (51/55)
MGI Phenotype FUNCTION: [Summary is not available for the mouse gene. This summary is for the human ortholog.] This gene encodes a member of the type I cytokine receptor family. The encoded protein heterodimerizes with interleukin 6 signal transducer to form the type II oncostatin M receptor and with interleukin 31 receptor A to form the interleukin 31 receptor, and thus transduces oncostatin M and interleukin 31 induced signaling events. Mutations in this gene have been associated with familial primary localized cutaneous amyloidosis. Alternatively spliced transcript variants encoding different isoforms have been found for this gene. [provided by RefSeq, Dec 2009]
PHENOTYPE: Mice homozygous for a knock-out allele exhibit anemia, decreased hematocrit, and reduced erythroid progenitor, erythrocyte, platelet, and megakaryocyte cells. Homozygotes also show increased susceptibility to diet-induced obesity. [provided by MGI curators]
Allele List at MGI
Other mutations in this stock
Total: 52 list
GeneRefVarChr/LocMutationPredicted EffectZygosity
2810474O19Rik T G 6: 149,326,030 S191R probably benign Het
Agbl4 A T 4: 111,566,742 M322L probably benign Het
Ankrd55 A G 13: 112,355,988 K231R probably benign Het
Asap1 A C 15: 64,127,423 M534R probably damaging Het
B4galnt2 T A 11: 95,876,314 probably benign Het
Cacna1e A T 1: 154,561,729 probably null Het
Cacna1h T C 17: 25,375,250 I2311M probably benign Het
Capn2 G T 1: 182,472,573 D617E possibly damaging Het
Catsper1 A G 19: 5,335,970 D77G probably damaging Het
Cdc42bpa A T 1: 180,094,533 probably benign Het
Cdca8 T C 4: 124,926,677 K109E probably damaging Het
Dbx1 A G 7: 49,633,494 S223P probably damaging Het
Dlg4 A G 11: 70,027,026 N45S possibly damaging Het
Dlgap2 T G 8: 14,822,691 V723G probably benign Het
Efl1 C A 7: 82,658,087 Q64K probably damaging Het
Eml1 T A 12: 108,506,612 probably benign Het
Fam129a A G 1: 151,714,523 I523V probably benign Het
Fbxw16 A G 9: 109,441,049 probably null Het
Gm10800 A T 2: 98,667,034 L80M probably benign Het
Gm5346 A G 8: 43,627,163 V8A possibly damaging Het
Hist4h4 A G 6: 136,804,115 Y89H probably benign Het
Insig2 A T 1: 121,312,235 V112E probably damaging Het
Kcnip3 A G 2: 127,465,877 S123P probably damaging Het
Map3k9 T C 12: 81,734,077 probably null Het
Myo16 T C 8: 10,322,658 V119A probably damaging Het
Naa25 G A 5: 121,424,576 V474M probably benign Het
Nckap1 A T 2: 80,548,933 V219E probably damaging Het
Nrp1 G T 8: 128,500,673 probably null Het
Nsun4 A T 4: 116,048,584 D58E probably benign Het
Obscn G T 11: 59,044,057 A5249D probably damaging Het
Olfr1055 A T 2: 86,347,339 H142Q probably benign Het
Pi4k2a T C 19: 42,119,836 probably null Het
Pram1 C T 17: 33,644,904 Q572* probably null Het
Prdm5 C A 6: 65,779,174 T25K probably damaging Het
Psen1 T C 12: 83,724,665 Y240H probably damaging Het
Pygl C T 12: 70,201,892 G318S probably benign Het
Rbck1 A C 2: 152,318,451 M436R probably benign Het
Rmnd1 T C 10: 4,427,488 N64D possibly damaging Het
Rsph4a A G 10: 33,908,279 D299G probably damaging Het
Sema4c T C 1: 36,551,731 S480G probably benign Het
Srp68 T C 11: 116,245,812 D552G probably damaging Het
Syde2 G T 3: 146,002,009 A568S probably damaging Het
Szrd1 G T 4: 141,139,781 probably null Het
Szt2 A T 4: 118,369,616 probably null Het
Tbc1d31 A G 15: 57,955,401 E800G probably benign Het
Tmprss11d C A 5: 86,309,263 probably null Het
Usp37 A G 1: 74,441,561 V895A probably damaging Het
Vmn1r19 T C 6: 57,405,041 I193T probably benign Het
Vmn2r102 T C 17: 19,677,572 V283A probably benign Het
Vps13d C T 4: 145,088,241 G3180D probably damaging Het
Xirp2 A C 2: 67,514,477 D2354A probably benign Het
Zc3h14 T A 12: 98,757,206 probably null Het
Other mutations in Osmr
AlleleSourceChrCoordTypePredicted EffectPPH Score
IGL00163:Osmr APN 15 6844445 nonsense probably null
IGL00335:Osmr APN 15 6837023 missense probably benign 0.00
IGL00497:Osmr APN 15 6847066 missense probably benign 0.26
IGL00510:Osmr APN 15 6823631 nonsense probably null
IGL00811:Osmr APN 15 6815666 missense probably benign 0.28
IGL00959:Osmr APN 15 6824605 missense probably benign 0.12
IGL01115:Osmr APN 15 6847201 splice site probably benign
IGL01307:Osmr APN 15 6844427 missense probably damaging 1.00
IGL01330:Osmr APN 15 6842028 missense probably damaging 1.00
IGL01633:Osmr APN 15 6824604 missense probably damaging 1.00
IGL01780:Osmr APN 15 6828663 missense probably benign 0.00
IGL02164:Osmr APN 15 6842048 missense probably damaging 0.99
IGL02207:Osmr APN 15 6847147 missense probably benign 0.07
IGL02338:Osmr APN 15 6837729 nonsense probably null
IGL02350:Osmr APN 15 6828663 missense probably benign 0.00
IGL02357:Osmr APN 15 6828663 missense probably benign 0.00
IGL02545:Osmr APN 15 6823579 missense probably damaging 0.98
IGL02619:Osmr APN 15 6841994 missense probably damaging 1.00
IGL02685:Osmr APN 15 6815573 missense probably benign 0.00
IGL02959:Osmr APN 15 6815897 missense possibly damaging 0.93
IGL03303:Osmr APN 15 6842808 missense probably benign 0.03
FR4548:Osmr UTSW 15 6837703 small insertion probably benign
FR4737:Osmr UTSW 15 6837706 nonsense probably null
R0149:Osmr UTSW 15 6841951 critical splice donor site probably null
R0361:Osmr UTSW 15 6841951 critical splice donor site probably null
R0492:Osmr UTSW 15 6824518 missense probably damaging 1.00
R0538:Osmr UTSW 15 6841938 splice site probably benign
R0585:Osmr UTSW 15 6837793 missense probably benign
R0980:Osmr UTSW 15 6852440 missense probably benign 0.00
R1221:Osmr UTSW 15 6823561 nonsense probably null
R1922:Osmr UTSW 15 6844367 missense possibly damaging 0.67
R2067:Osmr UTSW 15 6815415 missense probably benign 0.00
R2136:Osmr UTSW 15 6852462 missense probably damaging 1.00
R2156:Osmr UTSW 15 6844410 missense probably benign 0.04
R3683:Osmr UTSW 15 6837053 missense possibly damaging 0.95
R3735:Osmr UTSW 15 6822080 missense probably damaging 1.00
R3736:Osmr UTSW 15 6822080 missense probably damaging 1.00
R4011:Osmr UTSW 15 6824533 missense probably benign 0.01
R4175:Osmr UTSW 15 6852546 missense probably damaging 1.00
R4555:Osmr UTSW 15 6815720 missense possibly damaging 0.73
R4581:Osmr UTSW 15 6842894 missense probably benign 0.00
R4751:Osmr UTSW 15 6842852 missense probably damaging 1.00
R4758:Osmr UTSW 15 6852555 missense probably benign 0.23
R4986:Osmr UTSW 15 6816580 critical splice donor site probably null
R4997:Osmr UTSW 15 6815639 missense probably benign 0.25
R5093:Osmr UTSW 15 6821079 missense probably damaging 0.96
R5120:Osmr UTSW 15 6827275 missense probably benign 0.16
R5331:Osmr UTSW 15 6842881 missense probably damaging 1.00
R5812:Osmr UTSW 15 6837059 missense probably damaging 0.99
R5819:Osmr UTSW 15 6815787 missense probably benign 0.00
R5876:Osmr UTSW 15 6821047 missense probably benign 0.07
R5986:Osmr UTSW 15 6844453 missense probably benign 0.36
R6018:Osmr UTSW 15 6815795 missense probably damaging 1.00
R6164:Osmr UTSW 15 6860352 missense probably benign 0.00
R6217:Osmr UTSW 15 6823566 missense probably damaging 1.00
R6312:Osmr UTSW 15 6823638 missense probably damaging 1.00
R6349:Osmr UTSW 15 6821063 missense probably benign 0.00
R6898:Osmr UTSW 15 6815883 missense probably damaging 0.97
R7139:Osmr UTSW 15 6821088 missense possibly damaging 0.79
R7412:Osmr UTSW 15 6823567 missense probably damaging 1.00
R7527:Osmr UTSW 15 6827122 missense probably damaging 1.00
R7630:Osmr UTSW 15 6816971 missense possibly damaging 0.53
R7730:Osmr UTSW 15 6824482 missense probably damaging 1.00
R7990:Osmr UTSW 15 6852467 missense possibly damaging 0.87
R8094:Osmr UTSW 15 6815621 missense possibly damaging 0.64
R8187:Osmr UTSW 15 6821004 missense probably damaging 1.00
R8260:Osmr UTSW 15 6815416 missense probably benign 0.41
R8366:Osmr UTSW 15 6820954 missense possibly damaging 0.82
RF040:Osmr UTSW 15 6837701 small insertion probably benign
RF055:Osmr UTSW 15 6837700 small insertion probably benign
Predicted Primers PCR Primer
(F):5'- TTACTCGAGACAAAGAGAACAGTAC -3'
(R):5'- TCACACGGAAGTTTAAGCTGC -3'

Sequencing Primer
(F):5'- ACCAAATATTCTTTTAGGACCCTTCG -3'
(R):5'- AGCTGCTATTTTCCCAGAAGG -3'
Posted On2016-07-22