Mutagenetix > Incidental Mutations

Incidental Mutation 'R5077:Cacna1h'

401960

Institutional Source

Beutler Lab

Gene Symbol

Cacna1h

Ensembl Gene

ENSMUSG00000024112

Gene Name

calcium channel, voltage-dependent, T type, alpha 1H subunit

Synonyms

Cav3.2, alpha13.2, T-type Cav3.2

MMRRC Submission

042666-MU

Accession Numbers

Is this an essential gene?

Non essential (E-score: 0.000) question?

Stock #

R5077 (G1)

Quality Score

225

Status

Validated

Chromosome

Chromosomal Location

25374285-25433783 bp(-) (GRCm38)

Type of Mutation

missense

DNA Base Change (assembly)

T to C at 25375250 bp

Zygosity

Heterozygous

Amino Acid Change

Isoleucine to Methionine at position 2311 (I2311M)

Ref Sequence

ENSEMBL: ENSMUSP00000125541 (fasta)

Gene Model

predicted gene model for transcript(s): [ENSMUST00000024999] [ENSMUST00000078496] [ENSMUST00000159048] [ENSMUST00000159610] [ENSMUST00000160377] [ENSMUST00000160485] [ENSMUST00000160920] [ENSMUST00000162021]

Predicted Effect

probably benign
Transcript: ENSMUST00000024999

SMART Domains

Protein: ENSMUSP00000024999
Gene: ENSMUSG00000033200

Domain	Start	End	E-Value	Type
Tryp_SPc	29	257	1.06e-87	SMART
transmembrane domain	274	296	N/A	INTRINSIC

Predicted Effect

probably benign
Transcript: ENSMUST00000078496
AA Change: I2311M

PolyPhen 2 Score 0.016 (Sensitivity: 0.95; Specificity: 0.79)

SMART Domains

Protein: ENSMUSP00000077586
Gene: ENSMUSG00000024112
AA Change: I2311M

Domain	Start	End	E-Value	Type
low complexity region	16	36	N/A	INTRINSIC
Pfam:Ion_trans	138	418	8.4e-65	PFAM
low complexity region	500	511	N/A	INTRINSIC
low complexity region	515	531	N/A	INTRINSIC
low complexity region	557	568	N/A	INTRINSIC
low complexity region	708	723	N/A	INTRINSIC
Pfam:Ion_trans	824	1011	4.7e-46	PFAM
low complexity region	1130	1147	N/A	INTRINSIC
low complexity region	1248	1259	N/A	INTRINSIC
Pfam:Ion_trans	1341	1565	4.5e-56	PFAM
low complexity region	1576	1602	N/A	INTRINSIC
Pfam:Ion_trans	1656	1864	7.8e-48	PFAM
Pfam:PKD_channel	1714	1871	1.2e-10	PFAM
Blast:Tryp_SPc	1915	2077	1e-38	BLAST
low complexity region	2086	2097	N/A	INTRINSIC

Predicted Effect

probably benign
Transcript: ENSMUST00000159048

SMART Domains

Protein: ENSMUSP00000123741
Gene: ENSMUSG00000024112

Domain	Start	End	E-Value	Type
Pfam:Ion_trans	32	312	8e-65	PFAM
low complexity region	394	405	N/A	INTRINSIC
low complexity region	409	425	N/A	INTRINSIC
low complexity region	451	462	N/A	INTRINSIC
low complexity region	602	617	N/A	INTRINSIC
Pfam:Ion_trans	718	905	4.6e-46	PFAM
low complexity region	1024	1041	N/A	INTRINSIC
low complexity region	1142	1153	N/A	INTRINSIC
Pfam:Ion_trans	1235	1459	4.3e-56	PFAM
low complexity region	1470	1496	N/A	INTRINSIC
Pfam:PKD_channel	1524	1608	1.6e-6	PFAM
Pfam:Ion_trans	1550	1758	7.6e-48	PFAM
Pfam:PKD_channel	1609	1765	1.2e-10	PFAM
Blast:Tryp_SPc	1809	1854	9e-6	BLAST

Predicted Effect

noncoding transcript
Transcript: ENSMUST00000159331

Predicted Effect

probably benign
Transcript: ENSMUST00000159610
AA Change: I2311M

PolyPhen 2 Score 0.016 (Sensitivity: 0.95; Specificity: 0.79)

SMART Domains

Protein: ENSMUSP00000125541
Gene: ENSMUSG00000024112
AA Change: I2311M

Domain	Start	End	E-Value	Type
low complexity region	16	36	N/A	INTRINSIC
Pfam:Ion_trans	99	430	7e-79	PFAM
low complexity region	500	511	N/A	INTRINSIC
low complexity region	515	531	N/A	INTRINSIC
low complexity region	557	568	N/A	INTRINSIC
low complexity region	708	723	N/A	INTRINSIC
Pfam:Ion_trans	789	1023	2.4e-58	PFAM
low complexity region	1130	1147	N/A	INTRINSIC
low complexity region	1248	1259	N/A	INTRINSIC
Pfam:Ion_trans	1304	1577	4.5e-65	PFAM
Pfam:Ion_trans	1621	1876	4.2e-59	PFAM
Pfam:PKD_channel	1629	1715	9.3e-7	PFAM
Pfam:PKD_channel	1713	1871	2.2e-11	PFAM
Blast:Tryp_SPc	1915	2077	1e-38	BLAST
low complexity region	2086	2097	N/A	INTRINSIC

Predicted Effect

probably benign
Transcript: ENSMUST00000160377

SMART Domains

Protein: ENSMUSP00000124008
Gene: ENSMUSG00000033200

Domain	Start	End	E-Value	Type
Tryp_SPc	4	154	1.79e-30	SMART
transmembrane domain	171	193	N/A	INTRINSIC

Predicted Effect

probably benign
Transcript: ENSMUST00000160485

SMART Domains

Protein: ENSMUSP00000124721
Gene: ENSMUSG00000033200

Domain	Start	End	E-Value	Type
Tryp_SPc	4	154	1.79e-30	SMART

Predicted Effect

probably benign
Transcript: ENSMUST00000160920

SMART Domains

Protein: ENSMUSP00000123828
Gene: ENSMUSG00000033200

Domain	Start	End	E-Value	Type
Tryp_SPc	1	184	7.18e-44	SMART
transmembrane domain	201	223	N/A	INTRINSIC

Predicted Effect

probably benign
Transcript: ENSMUST00000161035

SMART Domains

Protein: ENSMUSP00000123906
Gene: ENSMUSG00000024112

Domain	Start	End	E-Value	Type
Pfam:Ion_trans	1	73	2.1e-9	PFAM
Pfam:Ion_trans	72	170	2.8e-17	PFAM
Blast:Tryp_SPc	209	291	3e-13	BLAST

Predicted Effect

probably benign
Transcript: ENSMUST00000161658

Predicted Effect

probably benign
Transcript: ENSMUST00000162021

SMART Domains

Protein: ENSMUSP00000125180
Gene: ENSMUSG00000033200

Domain	Start	End	E-Value	Type
Tryp_SPc	5	111	2.35e-4	SMART
transmembrane domain	128	150	N/A	INTRINSIC

Meta Mutation Damage Score

0.0898

Coding Region Coverage

1x: 99.3%
3x: 98.7%
10x: 97.4%
20x: 95.7%

Validation Efficiency

93% (51/55)

MGI Phenotype

FUNCTION: Voltage-dependent Ca(2+) channels mediate the entry of Ca(2+) ions into excitable cells and are involved in a variety of Ca(2+)-dependent processes, including muscle contraction, hormone or neurotransmitter release, and gene expression. The protein encoded by this gene is an integral membrane protein that belongs to the calcium channel alpha-1 subunits family. Two transcript variants encoding different isoforms have been found for this gene. [provided by RefSeq, Jul 2009]
PHENOTYPE: Mutation of this locus results in constitutive coronary arteriole contraction and focal myocardial fibrosis. [provided by MGI curators]

Allele List at MGI

Other mutations in this stock

Total: 52 list
Gene	Ref	Var	Chr/Loc	Mutation	Predicted Effect	Zygosity
2810474O19Rik	T	G	6: 149,326,030	S191R	probably benign	Het
Agbl4	A	T	4: 111,566,742	M322L	probably benign	Het
Ankrd55	A	G	13: 112,355,988	K231R	probably benign	Het
Asap1	A	C	15: 64,127,423	M534R	probably damaging	Het
B4galnt2	T	A	11: 95,876,314		probably benign	Het
Cacna1e	A	T	1: 154,561,729		probably null	Het
Capn2	G	T	1: 182,472,573	D617E	possibly damaging	Het
Catsper1	A	G	19: 5,335,970	D77G	probably damaging	Het
Cdc42bpa	A	T	1: 180,094,533		probably benign	Het
Cdca8	T	C	4: 124,926,677	K109E	probably damaging	Het
Dbx1	A	G	7: 49,633,494	S223P	probably damaging	Het
Dlg4	A	G	11: 70,027,026	N45S	possibly damaging	Het
Dlgap2	T	G	8: 14,822,691	V723G	probably benign	Het
Efl1	C	A	7: 82,658,087	Q64K	probably damaging	Het
Eml1	T	A	12: 108,506,612		probably benign	Het
Fam129a	A	G	1: 151,714,523	I523V	probably benign	Het
Fbxw16	A	G	9: 109,441,049		probably null	Het
Gm10800	A	T	2: 98,667,034	L80M	probably benign	Het
Gm5346	A	G	8: 43,627,163	V8A	possibly damaging	Het
Hist4h4	A	G	6: 136,804,115	Y89H	probably benign	Het
Insig2	A	T	1: 121,312,235	V112E	probably damaging	Het
Kcnip3	A	G	2: 127,465,877	S123P	probably damaging	Het
Map3k9	T	C	12: 81,734,077		probably null	Het
Myo16	T	C	8: 10,322,658	V119A	probably damaging	Het
Naa25	G	A	5: 121,424,576	V474M	probably benign	Het
Nckap1	A	T	2: 80,548,933	V219E	probably damaging	Het
Nrp1	G	T	8: 128,500,673		probably null	Het
Nsun4	A	T	4: 116,048,584	D58E	probably benign	Het
Obscn	G	T	11: 59,044,057	A5249D	probably damaging	Het
Olfr1055	A	T	2: 86,347,339	H142Q	probably benign	Het
Osmr	A	T	15: 6,844,393	Y174*	probably null	Het
Pi4k2a	T	C	19: 42,119,836		probably null	Het
Pram1	C	T	17: 33,644,904	Q572*	probably null	Het
Prdm5	C	A	6: 65,779,174	T25K	probably damaging	Het
Psen1	T	C	12: 83,724,665	Y240H	probably damaging	Het
Pygl	C	T	12: 70,201,892	G318S	probably benign	Het
Rbck1	A	C	2: 152,318,451	M436R	probably benign	Het
Rmnd1	T	C	10: 4,427,488	N64D	possibly damaging	Het
Rsph4a	A	G	10: 33,908,279	D299G	probably damaging	Het
Sema4c	T	C	1: 36,551,731	S480G	probably benign	Het
Srp68	T	C	11: 116,245,812	D552G	probably damaging	Het
Syde2	G	T	3: 146,002,009	A568S	probably damaging	Het
Szrd1	G	T	4: 141,139,781		probably null	Het
Szt2	A	T	4: 118,369,616		probably null	Het
Tbc1d31	A	G	15: 57,955,401	E800G	probably benign	Het
Tmprss11d	C	A	5: 86,309,263		probably null	Het
Usp37	A	G	1: 74,441,561	V895A	probably damaging	Het
Vmn1r19	T	C	6: 57,405,041	I193T	probably benign	Het
Vmn2r102	T	C	17: 19,677,572	V283A	probably benign	Het
Vps13d	C	T	4: 145,088,241	G3180D	probably damaging	Het
Xirp2	A	C	2: 67,514,477	D2354A	probably benign	Het
Zc3h14	T	A	12: 98,757,206		probably null	Het

Other mutations in Cacna1h

Allele	Source	Chr	Coord	Type	Predicted Effect	PPH Score
IGL00505:Cacna1h	APN	17	25381508	missense	probably damaging	1.00
IGL01412:Cacna1h	APN	17	25391950	missense	probably benign	0.24
IGL01625:Cacna1h	APN	17	25383485	missense	probably damaging	0.97
IGL01625:Cacna1h	APN	17	25385712	missense	possibly damaging	0.95
IGL01684:Cacna1h	APN	17	25388716	missense	probably damaging	1.00
IGL01862:Cacna1h	APN	17	25383483	missense	probably damaging	1.00
IGL01877:Cacna1h	APN	17	25388050	missense	probably damaging	1.00
IGL02040:Cacna1h	APN	17	25397611	missense	probably benign	0.10
IGL02190:Cacna1h	APN	17	25433026	missense	probably benign
IGL02686:Cacna1h	APN	17	25385749	missense	possibly damaging	0.80
IGL02883:Cacna1h	APN	17	25380532	missense	probably damaging	1.00
IGL02945:Cacna1h	APN	17	25388059	missense	probably damaging	1.00
IGL03025:Cacna1h	APN	17	25432894	nonsense	probably null
IGL03095:Cacna1h	APN	17	25383778	unclassified	probably benign
IGL03207:Cacna1h	APN	17	25391333	missense	probably damaging	1.00
IGL02991:Cacna1h	UTSW	17	25391312	missense	possibly damaging	0.56
IGL03097:Cacna1h	UTSW	17	25391144	missense	probably damaging	1.00
R0010:Cacna1h	UTSW	17	25380844	missense	probably damaging	1.00
R0194:Cacna1h	UTSW	17	25380924	unclassified	probably benign
R0361:Cacna1h	UTSW	17	25389422	missense	probably damaging	1.00
R0501:Cacna1h	UTSW	17	25388667	missense	probably damaging	1.00
R0558:Cacna1h	UTSW	17	25381550	missense	probably damaging	1.00
R0588:Cacna1h	UTSW	17	25387564	missense	probably damaging	1.00
R0626:Cacna1h	UTSW	17	25393546	missense	possibly damaging	0.92
R0811:Cacna1h	UTSW	17	25388628	missense	probably damaging	1.00
R0812:Cacna1h	UTSW	17	25388628	missense	probably damaging	1.00
R0964:Cacna1h	UTSW	17	25378775	unclassified	probably benign
R1351:Cacna1h	UTSW	17	25391951	missense	probably benign	0.14
R1457:Cacna1h	UTSW	17	25397620	missense	probably damaging	1.00
R1521:Cacna1h	UTSW	17	25397354	missense	possibly damaging	0.57
R1564:Cacna1h	UTSW	17	25377861	nonsense	probably null
R1611:Cacna1h	UTSW	17	25381471	missense	probably damaging	1.00
R1669:Cacna1h	UTSW	17	25383471	missense	probably damaging	1.00
R1835:Cacna1h	UTSW	17	25392076	missense	probably benign	0.01
R1858:Cacna1h	UTSW	17	25380807	missense	probably damaging	1.00
R1887:Cacna1h	UTSW	17	25376887	missense	probably benign	0.01
R2039:Cacna1h	UTSW	17	25391845	missense	probably benign	0.03
R2091:Cacna1h	UTSW	17	25432876	missense	possibly damaging	0.95
R2133:Cacna1h	UTSW	17	25383528	missense	probably damaging	1.00
R2203:Cacna1h	UTSW	17	25380260	missense	probably damaging	1.00
R2205:Cacna1h	UTSW	17	25380260	missense	probably damaging	1.00
R2206:Cacna1h	UTSW	17	25385013	missense	probably benign	0.10
R2207:Cacna1h	UTSW	17	25385013	missense	probably benign	0.10
R2224:Cacna1h	UTSW	17	25385943	missense	probably benign	0.03
R2226:Cacna1h	UTSW	17	25385943	missense	probably benign	0.03
R2261:Cacna1h	UTSW	17	25433165	missense	possibly damaging	0.91
R2361:Cacna1h	UTSW	17	25384012	missense	probably damaging	1.00
R2917:Cacna1h	UTSW	17	25395452	missense	probably damaging	0.97
R3031:Cacna1h	UTSW	17	25433134	missense	probably damaging	0.99
R3856:Cacna1h	UTSW	17	25392453	missense	probably damaging	1.00
R4230:Cacna1h	UTSW	17	25387863	missense	probably damaging	1.00
R4408:Cacna1h	UTSW	17	25380627	missense	probably damaging	1.00
R4687:Cacna1h	UTSW	17	25393910	missense	possibly damaging	0.47
R4887:Cacna1h	UTSW	17	25377287	missense	possibly damaging	0.86
R4895:Cacna1h	UTSW	17	25389422	missense	probably damaging	0.99
R5067:Cacna1h	UTSW	17	25397808	missense	probably damaging	1.00
R5148:Cacna1h	UTSW	17	25387545	missense	probably damaging	1.00
R5336:Cacna1h	UTSW	17	25392231	missense	probably damaging	0.99
R5450:Cacna1h	UTSW	17	25383186	missense	probably damaging	1.00
R5616:Cacna1h	UTSW	17	25377667	missense	probably damaging	1.00
R5738:Cacna1h	UTSW	17	25387049	missense	probably damaging	0.99
R5883:Cacna1h	UTSW	17	25376922	missense	probably benign	0.00
R5954:Cacna1h	UTSW	17	25383201	missense	probably damaging	1.00
R5961:Cacna1h	UTSW	17	25377272	missense	probably benign	0.01
R6110:Cacna1h	UTSW	17	25391276	missense	probably benign	0.10
R6125:Cacna1h	UTSW	17	25385694	missense	probably benign	0.00
R6189:Cacna1h	UTSW	17	25397844	missense	probably damaging	1.00
R6216:Cacna1h	UTSW	17	25378819	missense	probably damaging	1.00
R6259:Cacna1h	UTSW	17	25397656	critical splice acceptor site	probably null
R6296:Cacna1h	UTSW	17	25383079	missense	probably damaging	1.00
R6394:Cacna1h	UTSW	17	25387481	missense	probably benign	0.32
R6695:Cacna1h	UTSW	17	25393740	missense	probably damaging	1.00
R6746:Cacna1h	UTSW	17	25381550	missense	probably damaging	1.00
R6914:Cacna1h	UTSW	17	25385039	missense	probably benign
R6942:Cacna1h	UTSW	17	25385039	missense	probably benign
R6955:Cacna1h	UTSW	17	25388056	missense	probably damaging	1.00
R7041:Cacna1h	UTSW	17	25394003	missense	probably damaging	0.98
R7120:Cacna1h	UTSW	17	25391507	missense	probably benign	0.31
R7125:Cacna1h	UTSW	17	25383536	missense	probably damaging	0.99
R7182:Cacna1h	UTSW	17	25377655	missense	probably damaging	1.00
R7270:Cacna1h	UTSW	17	25384765	missense	probably damaging	1.00
R7274:Cacna1h	UTSW	17	25378837	missense	probably damaging	1.00
R7319:Cacna1h	UTSW	17	25389461	missense	possibly damaging	0.94
R7406:Cacna1h	UTSW	17	25385626	missense	possibly damaging	0.56
R7634:Cacna1h	UTSW	17	25392109	missense	possibly damaging	0.87
R7684:Cacna1h	UTSW	17	25389372	missense	probably damaging	0.99
R7769:Cacna1h	UTSW	17	25385805	missense	probably damaging	1.00
R7856:Cacna1h	UTSW	17	25389477	missense	probably damaging	0.98
R7876:Cacna1h	UTSW	17	25375251	missense	probably benign
R7898:Cacna1h	UTSW	17	25392276	missense	probably damaging	1.00
R7939:Cacna1h	UTSW	17	25389477	missense	probably damaging	0.98
R7959:Cacna1h	UTSW	17	25375251	missense	probably benign
R7981:Cacna1h	UTSW	17	25392276	missense	probably damaging	1.00
V1662:Cacna1h	UTSW	17	25377309	missense	possibly damaging	0.68

Predicted Primers

PCR Primer
(F):5'- AATGCCAAAGCCCTGTGGAC -3'
(R):5'- AGGAGGCAACACTACTCTGAGG -3'

Sequencing Primer
(F):5'- GTGGACACACAGCCCAGTC -3'
(R):5'- ACTGCCCAGAGTCTACAGAGG -3'

Posted On

2016-07-22