Incidental Mutation 'R5077:Pram1'
ID401961
Institutional Source Beutler Lab
Gene Symbol Pram1
Ensembl Gene ENSMUSG00000032739
Gene NamePML-RAR alpha-regulated adaptor molecule 1
Synonyms
MMRRC Submission 042666-MU
Accession Numbers
Is this an essential gene? Non essential (E-score: 0.000) question?
Stock #R5077 (G1)
Quality Score225
Status Validated
Chromosome17
Chromosomal Location33638056-33645706 bp(+) (GRCm38)
Type of Mutationnonsense
DNA Base Change (assembly) C to T at 33644904 bp
ZygosityHeterozygous
Amino Acid Change Glutamine to Stop codon at position 572 (Q572*)
Ref Sequence ENSEMBL: ENSMUSP00000057065 (fasta)
Gene Model predicted gene model for transcript(s): [ENSMUST00000052079] [ENSMUST00000087582] [ENSMUST00000114385] [ENSMUST00000116619] [ENSMUST00000139302] [ENSMUST00000148178]
Predicted Effect probably null
Transcript: ENSMUST00000052079
AA Change: Q572*
SMART Domains Protein: ENSMUSP00000057065
Gene: ENSMUSG00000032739
AA Change: Q572*

DomainStartEndE-ValueType
internal_repeat_1 15 151 3.3e-6 PROSPERO
internal_repeat_1 237 378 3.3e-6 PROSPERO
low complexity region 393 404 N/A INTRINSIC
low complexity region 445 453 N/A INTRINSIC
low complexity region 458 471 N/A INTRINSIC
low complexity region 480 486 N/A INTRINSIC
SH3 581 655 1.09e0 SMART
Predicted Effect probably benign
Transcript: ENSMUST00000087582
SMART Domains Protein: ENSMUSP00000084864
Gene: ENSMUSG00000059208

DomainStartEndE-ValueType
low complexity region 2 13 N/A INTRINSIC
Pfam:HnRNP_M 40 69 2.7e-20 PFAM
RRM 71 144 2.35e-20 SMART
RRM 165 237 1.66e-20 SMART
low complexity region 257 274 N/A INTRINSIC
low complexity region 307 321 N/A INTRINSIC
low complexity region 350 356 N/A INTRINSIC
Blast:AAA 430 589 2e-50 BLAST
low complexity region 590 603 N/A INTRINSIC
RRM 614 685 1.51e-23 SMART
Predicted Effect probably benign
Transcript: ENSMUST00000114385
SMART Domains Protein: ENSMUSP00000110027
Gene: ENSMUSG00000059208

DomainStartEndE-ValueType
low complexity region 2 13 N/A INTRINSIC
Pfam:HnRNP_M 40 69 1.5e-20 PFAM
RRM 71 144 2.35e-20 SMART
low complexity region 164 175 N/A INTRINSIC
low complexity region 176 193 N/A INTRINSIC
RRM 204 276 1.66e-20 SMART
low complexity region 296 313 N/A INTRINSIC
internal_repeat_2 332 432 3.9e-5 PROSPERO
internal_repeat_2 479 581 3.9e-5 PROSPERO
low complexity region 591 602 N/A INTRINSIC
low complexity region 606 616 N/A INTRINSIC
low complexity region 629 642 N/A INTRINSIC
internal_repeat_1 643 676 1.39e-5 PROSPERO
Predicted Effect probably benign
Transcript: ENSMUST00000116619
Predicted Effect probably benign
Transcript: ENSMUST00000130946
SMART Domains Protein: ENSMUSP00000116671
Gene: ENSMUSG00000059208

DomainStartEndE-ValueType
low complexity region 28 42 N/A INTRINSIC
Predicted Effect probably benign
Transcript: ENSMUST00000139302
SMART Domains Protein: ENSMUSP00000115787
Gene: ENSMUSG00000059208

DomainStartEndE-ValueType
low complexity region 2 13 N/A INTRINSIC
Pfam:HnRNP_M 40 69 1.4e-20 PFAM
RRM 71 144 2.35e-20 SMART
RRM 165 237 1.66e-20 SMART
low complexity region 257 274 N/A INTRINSIC
low complexity region 307 321 N/A INTRINSIC
low complexity region 350 356 N/A INTRINSIC
Blast:AAA 430 589 8e-51 BLAST
low complexity region 590 603 N/A INTRINSIC
internal_repeat_1 611 635 5.49e-5 PROSPERO
Predicted Effect probably benign
Transcript: ENSMUST00000148178
SMART Domains Protein: ENSMUSP00000120115
Gene: ENSMUSG00000059208

DomainStartEndE-ValueType
low complexity region 2 13 N/A INTRINSIC
Pfam:HnRNP_M 40 69 2.2e-22 PFAM
RRM 71 144 2.35e-20 SMART
low complexity region 164 175 N/A INTRINSIC
low complexity region 176 193 N/A INTRINSIC
RRM 204 276 1.66e-20 SMART
low complexity region 296 313 N/A INTRINSIC
internal_repeat_2 332 432 6.64e-5 PROSPERO
internal_repeat_2 479 581 6.64e-5 PROSPERO
low complexity region 591 602 N/A INTRINSIC
low complexity region 606 616 N/A INTRINSIC
low complexity region 629 642 N/A INTRINSIC
RRM 653 724 1.51e-23 SMART
Predicted Effect noncoding transcript
Transcript: ENSMUST00000163245
Predicted Effect noncoding transcript
Transcript: ENSMUST00000166215
Meta Mutation Damage Score 0.9717 question?
Coding Region Coverage
  • 1x: 99.3%
  • 3x: 98.7%
  • 10x: 97.4%
  • 20x: 95.7%
Validation Efficiency 93% (51/55)
MGI Phenotype FUNCTION: [Summary is not available for the mouse gene. This summary is for the human ortholog.] The protein encoded by this gene is similar to FYN binding protein (FYB/SLAP-130), an adaptor protein involved in T cell receptor mediated signaling. This gene is expressed and regulated during normal myelopoiesis. The expression of this gene is induced by retinoic acid and is inhibited by the expression of PML-RARalpha, a fusion protein of promyelocytic leukemia (PML) and the retinoic acid receptor-alpha (RARalpha). [provided by RefSeq, Jul 2008]
PHENOTYPE: Homozygous null mice have neutrophils that exhibit decreased adhesion-dependent reactive oxygen intermediate production and degranulation. [provided by MGI curators]
Allele List at MGI
Other mutations in this stock
Total: 52 list
GeneRefVarChr/LocMutationPredicted EffectZygosity
2810474O19Rik T G 6: 149,326,030 S191R probably benign Het
Agbl4 A T 4: 111,566,742 M322L probably benign Het
Ankrd55 A G 13: 112,355,988 K231R probably benign Het
Asap1 A C 15: 64,127,423 M534R probably damaging Het
B4galnt2 T A 11: 95,876,314 probably benign Het
Cacna1e A T 1: 154,561,729 probably null Het
Cacna1h T C 17: 25,375,250 I2311M probably benign Het
Capn2 G T 1: 182,472,573 D617E possibly damaging Het
Catsper1 A G 19: 5,335,970 D77G probably damaging Het
Cdc42bpa A T 1: 180,094,533 probably benign Het
Cdca8 T C 4: 124,926,677 K109E probably damaging Het
Dbx1 A G 7: 49,633,494 S223P probably damaging Het
Dlg4 A G 11: 70,027,026 N45S possibly damaging Het
Dlgap2 T G 8: 14,822,691 V723G probably benign Het
Efl1 C A 7: 82,658,087 Q64K probably damaging Het
Eml1 T A 12: 108,506,612 probably benign Het
Fam129a A G 1: 151,714,523 I523V probably benign Het
Fbxw16 A G 9: 109,441,049 probably null Het
Gm10800 A T 2: 98,667,034 L80M probably benign Het
Gm5346 A G 8: 43,627,163 V8A possibly damaging Het
Hist4h4 A G 6: 136,804,115 Y89H probably benign Het
Insig2 A T 1: 121,312,235 V112E probably damaging Het
Kcnip3 A G 2: 127,465,877 S123P probably damaging Het
Map3k9 T C 12: 81,734,077 probably null Het
Myo16 T C 8: 10,322,658 V119A probably damaging Het
Naa25 G A 5: 121,424,576 V474M probably benign Het
Nckap1 A T 2: 80,548,933 V219E probably damaging Het
Nrp1 G T 8: 128,500,673 probably null Het
Nsun4 A T 4: 116,048,584 D58E probably benign Het
Obscn G T 11: 59,044,057 A5249D probably damaging Het
Olfr1055 A T 2: 86,347,339 H142Q probably benign Het
Osmr A T 15: 6,844,393 Y174* probably null Het
Pi4k2a T C 19: 42,119,836 probably null Het
Prdm5 C A 6: 65,779,174 T25K probably damaging Het
Psen1 T C 12: 83,724,665 Y240H probably damaging Het
Pygl C T 12: 70,201,892 G318S probably benign Het
Rbck1 A C 2: 152,318,451 M436R probably benign Het
Rmnd1 T C 10: 4,427,488 N64D possibly damaging Het
Rsph4a A G 10: 33,908,279 D299G probably damaging Het
Sema4c T C 1: 36,551,731 S480G probably benign Het
Srp68 T C 11: 116,245,812 D552G probably damaging Het
Syde2 G T 3: 146,002,009 A568S probably damaging Het
Szrd1 G T 4: 141,139,781 probably null Het
Szt2 A T 4: 118,369,616 probably null Het
Tbc1d31 A G 15: 57,955,401 E800G probably benign Het
Tmprss11d C A 5: 86,309,263 probably null Het
Usp37 A G 1: 74,441,561 V895A probably damaging Het
Vmn1r19 T C 6: 57,405,041 I193T probably benign Het
Vmn2r102 T C 17: 19,677,572 V283A probably benign Het
Vps13d C T 4: 145,088,241 G3180D probably damaging Het
Xirp2 A C 2: 67,514,477 D2354A probably benign Het
Zc3h14 T A 12: 98,757,206 probably null Het
Other mutations in Pram1
AlleleSourceChrCoordTypePredicted EffectPPH Score
IGL01633:Pram1 APN 17 33642135 missense possibly damaging 0.79
IGL01949:Pram1 APN 17 33641335 missense probably damaging 0.99
IGL01983:Pram1 APN 17 33640861 missense probably damaging 0.98
IGL03403:Pram1 APN 17 33642143 missense probably damaging 0.99
R0100:Pram1 UTSW 17 33641399 missense possibly damaging 0.56
R0412:Pram1 UTSW 17 33641506 missense probably benign 0.24
R1915:Pram1 UTSW 17 33641157 missense probably benign 0.34
R2216:Pram1 UTSW 17 33641284 missense probably benign 0.02
R4177:Pram1 UTSW 17 33641229 missense probably benign
R5007:Pram1 UTSW 17 33645437 missense probably damaging 1.00
R5381:Pram1 UTSW 17 33641626 missense probably damaging 1.00
R6063:Pram1 UTSW 17 33641412 nonsense probably null
R7815:Pram1 UTSW 17 33642132 missense probably benign 0.17
R8239:Pram1 UTSW 17 33641267 missense probably damaging 1.00
R8248:Pram1 UTSW 17 33641164 missense probably benign 0.00
Z1177:Pram1 UTSW 17 33641599 missense probably damaging 0.99
Predicted Primers PCR Primer
(F):5'- CAGATGAAATGCTGTCTACCCAG -3'
(R):5'- CGTGTGAATCACAATCTCACC -3'

Sequencing Primer
(F):5'- CCAGATGGCCTCAACAGGAG -3'
(R):5'- CCTTCAAACTTGGAGAACATCATG -3'
Posted On2016-07-22