Incidental Mutation 'R5077:Catsper1'
ID401962
Institutional Source Beutler Lab
Gene Symbol Catsper1
Ensembl Gene ENSMUSG00000038498
Gene Namecation channel, sperm associated 1
SynonymsKSper
MMRRC Submission 042666-MU
Accession Numbers
Is this an essential gene? Probably non essential (E-score: 0.118) question?
Stock #R5077 (G1)
Quality Score225
Status Not validated
Chromosome19
Chromosomal Location5335741-5344153 bp(+) (GRCm38)
Type of Mutationmissense
DNA Base Change (assembly) A to G at 5335970 bp
ZygosityHeterozygous
Amino Acid Change Aspartic acid to Glycine at position 77 (D77G)
Ref Sequence ENSEMBL: ENSMUSP00000045430 (fasta)
Gene Model predicted gene model for transcript(s): [ENSMUST00000043380]
Predicted Effect probably damaging
Transcript: ENSMUST00000043380
AA Change: D77G

PolyPhen 2 Score 0.985 (Sensitivity: 0.74; Specificity: 0.96)
SMART Domains Protein: ENSMUSP00000045430
Gene: ENSMUSG00000038498
AA Change: D77G

DomainStartEndE-ValueType
low complexity region 21 33 N/A INTRINSIC
low complexity region 128 141 N/A INTRINSIC
low complexity region 202 225 N/A INTRINSIC
low complexity region 230 242 N/A INTRINSIC
low complexity region 290 304 N/A INTRINSIC
low complexity region 308 321 N/A INTRINSIC
low complexity region 336 347 N/A INTRINSIC
Pfam:Ion_trans 350 584 1.7e-34 PFAM
Pfam:PKD_channel 439 583 6.5e-7 PFAM
Coding Region Coverage
  • 1x: 99.3%
  • 3x: 98.7%
  • 10x: 97.4%
  • 20x: 95.7%
Validation Efficiency 93% (51/55)
MGI Phenotype FUNCTION: [Summary is not available for the mouse gene. This summary is for the human ortholog.] Calcium ions play a primary role in the regulation of sperm motility. This gene belongs to a family of putative cation channels that are specific to spermatozoa and localize to the flagellum. The protein family features a single repeat with six membrane-spanning segments and a predicted calcium-selective pore region. [provided by RefSeq, Jul 2008]
PHENOTYPE: Homozygotes for a targeted null mutation exhibit sperm with markedly decreased motility that are unable to fertilize ova and lack a calcium ion influx response to cyclic-AMP. [provided by MGI curators]
Allele List at MGI
Other mutations in this stock
Total: 52 list
GeneRefVarChr/LocMutationPredicted EffectZygosity
2810474O19Rik T G 6: 149,326,030 S191R probably benign Het
Agbl4 A T 4: 111,566,742 M322L probably benign Het
Ankrd55 A G 13: 112,355,988 K231R probably benign Het
Asap1 A C 15: 64,127,423 M534R probably damaging Het
B4galnt2 T A 11: 95,876,314 probably benign Het
Cacna1e A T 1: 154,561,729 probably null Het
Cacna1h T C 17: 25,375,250 I2311M probably benign Het
Capn2 G T 1: 182,472,573 D617E possibly damaging Het
Cdc42bpa A T 1: 180,094,533 probably benign Het
Cdca8 T C 4: 124,926,677 K109E probably damaging Het
Dbx1 A G 7: 49,633,494 S223P probably damaging Het
Dlg4 A G 11: 70,027,026 N45S possibly damaging Het
Dlgap2 T G 8: 14,822,691 V723G probably benign Het
Efl1 C A 7: 82,658,087 Q64K probably damaging Het
Eml1 T A 12: 108,506,612 probably benign Het
Fam129a A G 1: 151,714,523 I523V probably benign Het
Fbxw16 A G 9: 109,441,049 probably null Het
Gm10800 A T 2: 98,667,034 L80M probably benign Het
Gm5346 A G 8: 43,627,163 V8A possibly damaging Het
Hist4h4 A G 6: 136,804,115 Y89H probably benign Het
Insig2 A T 1: 121,312,235 V112E probably damaging Het
Kcnip3 A G 2: 127,465,877 S123P probably damaging Het
Map3k9 T C 12: 81,734,077 probably null Het
Myo16 T C 8: 10,322,658 V119A probably damaging Het
Naa25 G A 5: 121,424,576 V474M probably benign Het
Nckap1 A T 2: 80,548,933 V219E probably damaging Het
Nrp1 G T 8: 128,500,673 probably null Het
Nsun4 A T 4: 116,048,584 D58E probably benign Het
Obscn G T 11: 59,044,057 A5249D probably damaging Het
Olfr1055 A T 2: 86,347,339 H142Q probably benign Het
Osmr A T 15: 6,844,393 Y174* probably null Het
Pi4k2a T C 19: 42,119,836 probably null Het
Pram1 C T 17: 33,644,904 Q572* probably null Het
Prdm5 C A 6: 65,779,174 T25K probably damaging Het
Psen1 T C 12: 83,724,665 Y240H probably damaging Het
Pygl C T 12: 70,201,892 G318S probably benign Het
Rbck1 A C 2: 152,318,451 M436R probably benign Het
Rmnd1 T C 10: 4,427,488 N64D possibly damaging Het
Rsph4a A G 10: 33,908,279 D299G probably damaging Het
Sema4c T C 1: 36,551,731 S480G probably benign Het
Srp68 T C 11: 116,245,812 D552G probably damaging Het
Syde2 G T 3: 146,002,009 A568S probably damaging Het
Szrd1 G T 4: 141,139,781 probably null Het
Szt2 A T 4: 118,369,616 probably null Het
Tbc1d31 A G 15: 57,955,401 E800G probably benign Het
Tmprss11d C A 5: 86,309,263 probably null Het
Usp37 A G 1: 74,441,561 V895A probably damaging Het
Vmn1r19 T C 6: 57,405,041 I193T probably benign Het
Vmn2r102 T C 17: 19,677,572 V283A probably benign Het
Vps13d C T 4: 145,088,241 G3180D probably damaging Het
Xirp2 A C 2: 67,514,477 D2354A probably benign Het
Zc3h14 T A 12: 98,757,206 probably null Het
Other mutations in Catsper1
AlleleSourceChrCoordTypePredicted EffectPPH Score
IGL01084:Catsper1 APN 19 5337772 missense probably damaging 1.00
IGL01361:Catsper1 APN 19 5339479 missense probably damaging 1.00
IGL02413:Catsper1 APN 19 5336236 missense possibly damaging 0.46
IGL02560:Catsper1 APN 19 5336188 missense possibly damaging 0.93
IGL03335:Catsper1 APN 19 5336311 missense probably damaging 0.97
R0002:Catsper1 UTSW 19 5341523 splice site probably benign
R0164:Catsper1 UTSW 19 5339475 missense possibly damaging 0.93
R0164:Catsper1 UTSW 19 5339475 missense possibly damaging 0.93
R0324:Catsper1 UTSW 19 5336545 missense probably damaging 0.99
R1782:Catsper1 UTSW 19 5335909 missense probably benign 0.01
R2301:Catsper1 UTSW 19 5340398 missense probably benign 0.41
R3864:Catsper1 UTSW 19 5336176 missense possibly damaging 0.93
R4808:Catsper1 UTSW 19 5344136 missense possibly damaging 0.76
R4941:Catsper1 UTSW 19 5341438 missense possibly damaging 0.90
R4983:Catsper1 UTSW 19 5335963 missense probably benign 0.26
R5072:Catsper1 UTSW 19 5340046 splice site probably null
R5629:Catsper1 UTSW 19 5336137 missense probably benign 0.00
R6402:Catsper1 UTSW 19 5339496 missense probably damaging 1.00
R6875:Catsper1 UTSW 19 5343963 missense probably damaging 0.99
R7368:Catsper1 UTSW 19 5336663 missense unknown
R7510:Catsper1 UTSW 19 5339550 missense probably benign 0.26
R8837:Catsper1 UTSW 19 5336042 missense probably damaging 0.96
R9033:Catsper1 UTSW 19 5337836 critical splice donor site probably null
Z1177:Catsper1 UTSW 19 5343883 missense probably damaging 1.00
Predicted Primers PCR Primer
(F):5'- CGAGTCTTACCATGAGACACAC -3'
(R):5'- GGTGGGACAAAGGTTCACTG -3'

Sequencing Primer
(F):5'- CGGTAGCTTAGACCCAAGC -3'
(R):5'- ACAAAGGTTCACTGGGTCTATG -3'
Posted On2016-07-22